Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_PCDAM_all.Contig601
Contig Information
Length 819 bp
Tissue Anther at meiosis
Clones 2 Clones [Download: CSV  ,  FASTA ]
whpc10b24    rwhpc10b24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribosomal protein L36 [Triticum aestivum]
Score 496
Evalue 3.14968e-48
Total Hit Count 286
Registered year 2003
Contig Sequence     [ Download ]
>Wh_PCDAM_all.Contig601
GAATTGTTCAACAAGAAGAAAAACCAGTTCGTAGTATTGCAGATTATTATAGACGAAGTGCGCGGCCTGCAAGCCACTTTTTACCGGAGCCGGTATGTAC
TGCAAGCCACTTGAAGATTGGTGCGTGCTGTCTATATGCATACGAGTATTCCTTTGTATACTGTTGACAATACATTTCATATGGTGTTGTTCAACCCTCG
TGCCGAATTCGGCACGAGGTAGGGTTTCACTTGCATCCATTCTCAACGTTAGCAGGAGCGAGTGGGAGTCCGGCCATGGCGCCGTCGCAGCCCAAGTCAG
GGCTCTTCGTGGGCATCAACAAGGGCCACGTCGTCACCAAGCGCGAGCTGCCGCCTCGCCCGTCCGACCGCAAGGGGAAAGGTACAAAGAGGGTGCATTT
TGTCAGGAACTTGATCAGGGAGGTTGCTGGATTTGCTCCCTATGAGAAGCGTATCACTGAGCTTCTTAAGGTTGGAAAGGACAAGCGTGCACTCAAGGTC
GCCAAGAGAAAGCTTGGTACTCACAAGAGAGCAAAGAAGAAGAGAGAGGAGATGTCAAGTGTCCTTAGGAAGATGAGGTCTGCTGGTGGTGGTGCTGGTG
ACAAGAAGAAATAGAACTTGGCTAGCTGGTGAATTTTATCCGGAAGCAAAGTCCTGTATTACCAGTCCGTACCTATAGAGCTATGGCCATTGTGTTGACA
CTATCTTTAGCCCGTGGTTTCTATTTTGAGAAGACCAATCTTTTTAAGATTTTTATACATGAGTCTGGTGCCTTTGTTTGATTACTTGGTACTCTGCTGT
TTATTCAGTTATGTAGCTG
page-top