Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_PCDAM_all.Contig599
Contig Information
Length 722 bp
Tissue Anther at meiosis
Clones 2 Clones [Download: CSV  ,  FASTA ]
whpc10c02    rwhpc10c02   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_006954 [Oryza sativa (japonica cultivar-group)]
Score 395
Evalue 1.28348e-36
Total Hit Count 18
Registered year 2003
Contig Sequence     [ Download ]
>Wh_PCDAM_all.Contig599
TCTGGGGATCAAGAGAGCACGTGCGCCCCTGGTCCCAGTCAGAAGGAGAGCATCTGGTCGTGATGGATGACCAGGTGTGTATTGTCCGGAACCTTCGCAA
CGGAACCCCTCATGGTAGTGCCCTGGAGATTTGGGGGCTACTGGATTACGGCTCTGGTGATTGGACGCTGAATCATCGAATCGATTTGTTCGGGCACATT
AGAAGAGAATTAGGCGAGCCACAGGCTGTGAGAGTTATTGGTTCTCTTGGCAATTGCAGGTCAGGGAAGAAGATTGTCATTGCTACTAGCAAGCACTGGG
TTTATGAAAAGTTTCATAAAAAGGTTTACACCTATGATCCTAGCTGTCAGGTTCTAGAGGGCATTCTTTCGGTCACTGAGACACACACCTCTGTTCCATG
CTTCATCCCTGGTTCAAGATTCAGTTTATTTGAAGAGAGCCTTGCTCCAGTGCATAAAAGGGATGAAGAGGTTGCCCTGTCATCTACCCTGGCTAAGGCA
ACTAAAGAAACTACTACTTCCAAGCTAAAAGGTTAAAAGGCGAAAGGTCAGTATTGTGTAAATCAAGATCGGCATCTCCATGGCGTGTATTCTCAGGATA
TCAGTTAGCTGGTTTCGAATGTGTGCGGCAGAAATCAAGAGCTGATAATGCATATAGTACATGTAGAATGGCTCCAGCTACATGAAGAATCGGGTGTAGG
CTTGTTTTGCTTTGTTCTAAAA
page-top