Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_PCDAM_all.Contig571
Contig Information
Length 1037 bp
Tissue Anther at meiosis
Clones 2 Clones [Download: CSV  ,  FASTA ]
whpc10c06    rwhpc10c06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_34843 [Oryza sativa Indica Group]
Score 766
Evalue 2.2956e-79
Total Hit Count 230
Registered year 2003
Contig Sequence     [ Download ]
>Wh_PCDAM_all.Contig571
CCGACGCGCCACCACCTGCTCCTCCCGGCGGCTGCCTGCTCGACTCGATTCCCCAACCGCAGCAGGGTCAACGACAGAACCTATCGCGCGATGGGCTTGG
GACTGAGATTGCCGTTCTTCCTACTCCTCTTGCTGCTGGTCAGCCTGGGAGCCGCACAAGGGCCGGAGCACAGTTTTTTCTTGATATCCAGGAGGAGGCT
CGAGGCTCTGGTCAAATCATCAAGGATCAACTAACTTTGAGCAAAATTCCCGTGCGTGTTGAGAGGGGCAGCCCACTATGCCCAGCTTGTGAGAAGTTTA
CAGAGGAAGCTCTTAGCTATCTTAGTCAGAAACAATCACAAGATAAGATGATGGAGGTCCTTCATGAAGCTTGTTCTCAGACATTCTCGTTGGAAAAGAA
GTGTGTTGAGTTTGTGGACTCCTATGCAACTCTCTTATTTGCCAAGATCGCTGAGATCAAGCCAGAAGAGTTCTGCAAACGAAATGGCCTCTGCAGGGAC
AATGCTCTTCTGTCTGGTGTGAGAAGTGAGAGCACATGCGTGTTTTGCCACCACCTCATGGATGAAGTTTTGTCCAAACTGAAGGATCCTGATGCTGAGT
TTGAGATAATTCAAATTCTCCTCAAGGAGTGCAAGAAGATCGAAGGTCATGAACAGCAGTGCAAACGACTGGTCCTGCAATACATCCCTCTCATCCTGGT
GAACGGAGAGAAGTTCCTCGAGAAGAACGATATATGTACCATTGTCCAAGCGTGCGATGCTGGCAAAAAGACAATGGTCGGGCCATTCTCCGAGGAGGGT
TTGTTGCGTGATGCATGAAGGTAGAAAGACCACACCAGGCTGCGTAAACCCAGACGAAACATTATGCACTAGTTCTTCCTTGTTGTACATAGGTGTCCAA
AAATTCGTCTGGCTTTTGCCTTGTACTGCTGCTCCTGCATTCTGTGGATGCTTTGTATTATAAAGGGAGCGGCATGACAAACAGTTTATTATGTCAACTT
GAAGCCGTGTTGTACTTATTACTTCGTCAGTGTTAAT
page-top