Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_PCDAM_all.Contig554
Contig Information
Length 657 bp
Tissue Anther at meiosis
Clones 2 Clones [Download: CSV  ,  FASTA ]
whpc10c11    rwhpc10c11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit glycoprotein [Bromus inermis]
Score 592
Evalue 1.49287e-59
Total Hit Count 302
Registered year 2003
Contig Sequence     [ Download ]
>Wh_PCDAM_all.Contig554
GCCCGCCCACCCGTCTCCTCGCCTCGCCGTCTCGCCCCACGCCGCCGACGCAAAGATGCCGTTCAAGAGGTTCGTCGAGATCGGGCGCGTGGCCCTGGTG
AACTACGGCAAGGACTACGGCCGCCTCGTCGTCATCGTCGACGTCGTCGACCAGAACCGGGCACTTGTGGATGCTCCTGATATGGTCAGGTGCCAGATGA
ACTTCAAGCGTCTTTCGCTGACCGACATCAAGATTGACATCAAGCGTATCCCTAAGAAGGCAACTTTGATCAAGGCCATGGAGGAAGCAGATGTGAAAAC
CAAATGGGAGAACAGCTCATGGGGTAAGAAGCTTGTTGTCCAGAAGAGAAGAGCATCGCTGAATGACTTTGACAGGTTCAAGGTCATGTTGGCTAAGATT
AAGAGGGGTGGTGCGATCAGGCAAGAGCTTGCCAAGCTCAAGAAGGAGGTTGCTGCTTAGATTATCTTAGTGGATGGCATGTTGAGTTTTTTGTTCCAAG
TTGGATCTGCTCTATGTTCCAGTGTTCTTAAAGCCAGAATTAGTACAACTGTTTTCGGAGAACTACTTCATATTTTGTCATGGCTGTTATTGAATACCCC
AAGCTAGTTTGCTACAGATGTGCCTCTTGCCTTAATTCATTTGTGATAAAAAAAAAA
page-top