Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_PCDAM_all.Contig526
Contig Information
Length 721 bp
Tissue Anther at meiosis
Clones 2 Clones [Download: CSV  ,  FASTA ]
whpc10c19    rwhpc10c19   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit WCOR719
Score 567
Evalue 1.44493e-56
Total Hit Count 498
Registered year 2003
Contig Sequence     [ Download ]
>Wh_PCDAM_all.Contig526
CACCGCCAACCATCAGCTTTCAATCTAGCTACCAGTTCCAGTTTAGCACACAGATTTTTTCCTCGGGCCAACCTCCAGATCCATCAACAATGGCGAACTC
TGTGTCCGGAGTGGCGGTGAACGAGGAGTGCGTGAAGGCGTTCCAGGAGCTGCGGGCGGACCGCAAGCACCGGTTCGTGGTGTACAAGATGGACGACGAC
GCGCAGCAGGTGGTGGTGGACAAGGTGGGCGCGCTCGACGCCACCTTCGACGACCTGGCGGCGGCCATGCCCGCCGACGACTGCCGCTACGCCGTCTACG
ACCTGGACTTCGTGTCCGAGGACTCGGCCGGCGAGACCCCCCGCAGCAAGATCTTCTTCATCCACTGGTCGCCGGAGTCGGCGGACGCGAGGAACAAGAT
GCTGTACGCCAGCTCCACGGAGGGGCTCAAGAAGGAGCTGGACGGCGTGCAGATCGACGTGCAGGCCACCGACGCCAGCGAGCTCACCCTTGACATCCTC
AAGGACTACACCACCTAAGTTAATCGATGAATCACGTACGCGCTTGGCATCGCGTTCCTGCTTGGAGTTGGATCGTGTCTTGTGGATCCAAATAATGTTT
TTCCATGTGCAGCGGGGTGTGAATAATTGATGAGTGGTTTTCTTTTCGGGATTGATAATTGCGTGGTTTTTCTCTTCAAGAATGATAATTGAGTGGTTGA
TTTATTCCTTCAAAAAAAAAA
page-top