Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_PCDAM_all.Contig493
Contig Information
Length 687 bp
Tissue Anther at meiosis
Clones 2 Clones [Download: CSV  ,  FASTA ]
whpc10f08    rwhpc10f08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Trans-cinnamate 4-monooxygenase; AltName: Full=Cinnamic acid 4-hydroxylase; Short=CA4H; Short=C4H; AltName: Full=P450C4H; AltName: Full=Cytochrome P450 73 >gi|642954|gb|AAB42024.1| cinnamic acid 4-hydroxylase
Score 586
Evalue 8.25097e-59
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_PCDAM_all.Contig493
TGGCCATCCCGCTGCTGGTGCCCCACATGAACCTCCACGACGCCAAGCTCGCCGGCTACAACATCCCCGCCGAGAGCAAGATCCTCGTCAACGCCTGGTT
CCTCGCCAACAACCCGGAGCAGTGGAAGCGGCCCGACGAGTTCCGGCCGGAGCGCTTCCTGGAGGAGGAGAAGCACGTGGAGGCCAACGGCAACGACTTC
AGGTACTTGCCCTTCGGCGTCGGCCGCCGGAGCTGCCCCGGCATCATCCTCGCGCTGCCCATCCTCGGCATCACCATCGGCCGCCTCGTCCAGAACTTCG
TGCTCACGCCGCCGCCCGGCCAGGACAAGCTCGACACCACGGAGAAGGGCGGCCAGTTCAGCCTCCACATCCTCAAGCACTCCACCATCGTCGCCAAGCC
CAGAGTGTTCTAGAGCAGCGACGTACGTGCTCTGGAGTTTGGACTTCCAGCATTTTGGTTTGGTGGTGTTGTACTTTCACGATTGTTCGCTCGTCCTAAG
TATACTTGATTATAGTATCCGTCACAGAGTAGACACACGTTTCGTTAATGTTATCCGCAAGAAAACAGAGGAGCTGAAGAAATGTCGAACGGGGAGGAAA
AGACTGGACGATTTCCGTCAGATGTACTCCTGATGCTGCCATAAATTAAATCCTCAAAATATTGATGATTTTTTCACAAAAAAAAAA
page-top