Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_PCDAM_all.Contig407
Contig Information
Length 1356 bp
Tissue Anther at meiosis
Clones 2 Clones [Download: CSV  ,  FASTA ]
whpc10f24    rwhpc10f24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit membrane protein [Zea mays]
Score 1146
Evalue 2.94161e-123
Total Hit Count 54
Registered year 2003
Contig Sequence     [ Download ]
>Wh_PCDAM_all.Contig407
AAAAGAGAGAAAACATCGGAAGAGGACGGGAGAGGGAGGAAATTTGGAGTCGAGGGGGCAGGAGAAGGGGAGAGCAGAGAAGCTTGGAGGGCGGAGCGCG
TCGGCGATGGACGGCGAGTGGTGGAGGAAGAAGTGGGTGGCGTGGGCGGCGGCGGCGGCCATCTTCGTGGTGCTCATGCTCGTCACGCCCGCCATCCCGC
AGGACGAGGACTACCACGACTTCGCCGACCAGCGCGACCTCTTCCTAGGGATCCCTAACACATTGAATGTGCTCTCAAATATCCCTTTCCTCTTTGTTGG
TCTCGCTGGGCTCATCCTGTGCCACTACAAAAACTACTTCAGGCTATGCTCACAGGGGGAGCTCTGGAGTTGGACACTCTTCTATGCTGGTGTCACTACT
GTCGGTGTTGGTTCATCCTACTACCATCTCTACCCAAACGATGCCACCTTAGTTTGGGACAGATTGCCTATGACGATTGCTTTCACGTCTATTGTGGCCA
TTTTCATCATTGAAAGGGTTGATGATAGAGCAGGAACAAAGTCCCTTGCACCCCTTGTTATTGCTGGTGCACTGAGCATCCTGTACTGGAGTTTCTTTGA
TGATCTTCGGCCATATGCAATAATCCAGTTCGTTCCATGCATTGTAATACCTGTGATGGCTATAGTTATTCCACCAATGTATACACATTCAAGCTACTGG
TTGTGGGCAGCAGGATTTTACCTTCTTGCCAAAGTGGAAGAGGCTGCGGACAAACCTATATATAGGTGGACACATGACATTGTTAGCGGACACACTCTTA
AACATCTATGTGCTGCGATGGTACCTGTTTTCTTGACTCTCATGTTGGCAAAGAGGACAATTGAACCTGATAGGGTAAGCTTACTCCAGATGTGGAAGAT
CAGTTGGAGAGAACGTGGTTCCCAAGATAGCAACACTGTAGACGTCAAATATGATTATGCTGCAGTTTCAACTACGTCTGAACAACAGTAGATATGTGTT
CTTCATATGTACTCTACTCCCGAAGTGTAAAAATAGCATCGATCTGAATATCAGGAGCCCCAGCTTGCACGGTTGTGTATCATTGCCTGCTAATCAACGT
TCGTATGTTGTTGTTCCTGATCAAAACTTCCTGATCATATCTTGTACAGGAAGGAAAAATATATATTAGTTCCCTCATCAACTCTTTGTGCTCTAGTTTT
TGGGAACCTCAAACAGCCTATACCTCCTCCTGCACCTGGAAAGACCGTAGCCTATGTAACTGGACGGGGATCTATTGAGACTGCACCTGCTTCAGTTGTT
GCTGCTCTTCCGAGTTCATTAAGCTGCATGCTATGGGCTCAACGTCTTCCCGTGTG
page-top