Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_PCDAM_all.Contig389
Contig Information
Length 784 bp
Tissue Anther at meiosis
Clones 2 Clones [Download: CSV  ,  FASTA ]
whpc10g01    rwhpc10g01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit C-8,7-sterol isomerase [Hordeum vulgare]
Score 952
Evalue 1.59975e-110
Total Hit Count 165
Registered year 2003
Contig Sequence     [ Download ]
>Wh_PCDAM_all.Contig389
GGGCGCGCACCCTTACGTGCCGGCGGGCCTGGACCTCCCGGGCTACGTGCCGCTGCGCCTCACCCAGCTCGAGATCCTCGGGGGCCTACCTCGGCACCTC
CCTCTTCGTCCTCGTCGCCGTCTGGCTCCTCTCCGGGAGATGCCGCAGGTTGTCCGGGACCGACCGCCTGCTCATGTGCTGGTGGGCGTTCACCGGCCTC
ACCCACATACTCATCGAGGGGCCCTTCGTCTTTACCCCCGATTTCTTCACCAAGACCAACCCCAACTTCTTCGACGAAGTCTGGAAGGAGTACAGCAAGG
GTGACTCCAGGTACGTCGCCAGGGACACCGCCACCGTCACCGTCGAGGGAATCACGGCCGTGCTGAAAGGCCCTGCCTCGCTGCTCGCAGTCTATGCTAT
CGCGTCGCGAAAGTCCTACAGCCACATCCTCCAGTTTGCCGTGTGCCTCGGTCAGCTCTACGGATGCATCGTCTACTTCACCACCGCCTACTTGGACGGC
TTCAACTTCTGGGCCAGCCCGTTCTACTTCTGGGCATATTTCATCGGCGCAAACAGTTTGTGGATTGTGATACCGTTGCTGATCGCCACAAGGAGCTGGA
AGAAGATCTGCGCGGCGGTTCATCAAAGCGAGAAGGTCAAGACCAAGTAATTCCAGCAACACAGAGGGTTGGTTGCAACCAGGACACACTGAAATTCTTG
TTTTACCACAATTTGCTTCCTTGTATTGTACCCTTTGTAAACTACATTGTCTGAAACAAAGTATGCAGTACTACAAAAAAAAAA
page-top