Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_PCDAM_all.Contig368
Contig Information
Length 806 bp
Tissue Anther at meiosis
Clones 2 Clones [Download: CSV  ,  FASTA ]
whpc10g11    rwhpc10g11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit DEHA2A07084p [Debaryomyces hansenii]
Score 84
Evalue 1.81851
Total Hit Count 52
Registered year 2003
Contig Sequence     [ Download ]
>Wh_PCDAM_all.Contig368
GCCCGATCCAACGCCTCGTCCGACGGCGCTGCCGGCCGGCGATGGATATGGAGAGGAGCTCGGGTCTTCCTTGTGTATATTAGGGCAGCAGTAGTTTTAG
TTTGTCTTGGCTTCATGCCGTGGTCTGGCGTTATGCCGTGGGGATGCAAACCACTGGAGCTCTCGAGCGGCGTCTGGTGGTGGCCTCCGTCGTTTTCTTT
CTTGCCACCATGGTGGTGGAAAGTGGAAGACGCCGGATCTGGCAAGATCCCCTTGAATAAGCTCGTTCTGGTGTTGTGGTGTTCCCTGATCTGGAGGGCA
TCCAACTGCTACTGCTTGTTTTCTCAGGCTACCATGGTGGTGGATGAGAAGCAGGATAGTTGCAGAATCCTGAAGTTTATAGGTCGAGTTCGAGCATATC
AGCAGAGGTCCCTTTGGTGGAGCGACGGCGCCCATCGATGGCTGCCGGTCTTCGTAGGTGCCCTGTTTCTTCTAGCCGAATGGCGGCTGACTATATTCCT
CCCGGCTTGCGTGCCTGATGGGAGGCAGTTCCAGTGGCGGCTCGGAGGCTATGGCGAGCAGGTGATGCTTCCATGGCGATTTCGTCGTGCCAAGTGGTTC
GTCCCCGGCGACGGCGAGGTTCAATCTGGGCGGCGGCTGTCAAGGACCCGATCGCGTTTCTTGCTTTCAGTCTGGGGTCCTCCTTGTAAAAGTCAGGGAC
TTAATGTAATGTTCCTTTCTATTTTGGTCCTGTTGTAATATGTACTGCCGTGTTTATCCAATGAANCCTGGGTCCTTCAANACCCACTTTCTGTTCAAAA
AAAAAA
page-top