Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_PCDAM_all.Contig265
Contig Information
Length 609 bp
Tissue Anther at meiosis
Clones 2 Clones [Download: CSV  ,  FASTA ]
whpc10h03    rwhpc10h03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_08036 [Oryza sativa Indica Group]
Score 529
Evalue 2.5936e-52
Total Hit Count 112
Registered year 2003
Contig Sequence     [ Download ]
>Wh_PCDAM_all.Contig265
CTCGCCCTCTCGCTCTCGCGTACTCGGCAAACCAGGGACGGCGACCGCTCTTCACCGCTGCCCCCCTTCTCCTCTCGGGCATCGGCAGATCTGCGCGGGC
CACTATCCTCTCCTTCCCCACAGTCCTTCCTAGCCATGGCTGGGAGGCACACCATTATTCTGATGCAACCATCCCAAAACAGGAGCTCCAGGACGTTCAT
GGATTATAATTCAATTAACCATGCATTGGATGGAATCTGTGGTCTCTATGAAAGGAAAATCAGGGATATCAACCCAATGATCCCGAACATAACCTATGAC
ATCACTGATCTGTACAACTTCATCGACGGCCTAGCTGACATCAGTGCGCTAGTCTATGATCACGAAATCCATGCGTTTCTGCCATATGACCGGCAGTGGA
TAAAGCAGAAGCTGTTTCAGCACCTTAAGAAGCTGGCTCAAAGATAGTGACTGGTGCGTGGTGTTTGGTTCAGTGTGTCGTCACCGGCAGGCATGTGTGA
TAATTTGTGTCCGATTAGTCCACCAGAAAGGTTTTTCTTGTACCAATGATGAGAATTTCACATGGCATGCTTATATTCTGGGTGTGAAACTCATAGCTTA
AAAAAAAAA
page-top