Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_PCDAM_all.Contig246
Contig Information
Length 1451 bp
Tissue Anther at meiosis
Clones 2 Clones [Download: CSV  ,  FASTA ]
whpc10g20    rwhpc10g20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os04g0466600 [Oryza sativa (japonica cultivar-group)] >gi|113564603|dbj|BAF14946.1| Os04g0466600 [Oryza sativa (japonica cultivar-group)] >gi|116309723|emb|CAH66768.1| OSIGBa0115M15.6 [Oryza sativa (indica cultivar-group)] >gi|215769308|dbj|BAH01537.1| unnamed protein product [Oryza sativa Japonica Group]
Score 993
Evalue 0
Total Hit Count 464
Registered year 2003
Contig Sequence     [ Download ]
>Wh_PCDAM_all.Contig246
TTCTCCATCCTCAGATCAGCGCAGCGGAAGATCGAATCAATCTAGGTTTGGCGAGAGCCGAGCCGAGGGGAGGGGAGGAGGATGGTGAAGGCCATGGCGG
GATGCCCGGCGAAGATGAGGTTCCGGATGCCCGCCGAGTGGGAGCCGCACGAGCAGTGCTGGATGGGCTGGCCGGAGCGTCCAGACAACTGGCGGGAGCA
TGCTGAGCCAGCTCGAAAAACATTTGAGAGAACTGCAATTGCCATTTCAAAGTTTGAGCCTGTCACCATTTGCGCAAGTGCCAAACAGTATCCTCGTGTC
CACGAGCTGATGGAACACCAACCGAACATCAGGGTGGTCGAGATGAGCATGAATGATTCCTGGTTCCGTGATACTGGTCCCACTTTTATTACCCGTGAAG
GCGGATCTGATATAGGACTCGCAGAGCAAACAATAGCGGGGATTGACTGGGAATTTAACGCATGGGGAGGACTCGGTGGTGGTTGCTTTGATGATTGGAG
TCTTGACAGAAGCATTGCCAAGAAGATAGTTGAGATTGAGAGGATCCCTAGGTTTGCACACACAATGGTTTCTTGAGGGTGGAAGCATTCATGTAGATGG
AGAAGGTACATGCATTACAACAGAAGAATGCTTGTTGAATCCTAACAGGAACCCTCACATGACTAAACTAGAGATAGAGAATGAACTGAAGGATTTTCTT
GGAGTCACGAAGATCATTTGGATACCTCTGGGACTACACGGTGACGAGGATACAAATGGGCATGTTGACAATTTATGCTGTTTCATCAAACCCGGCGTGA
TTCTCTTGTCATGGACGGATGACGAGAACGACCCGCAGTACGAGATATCTGTGAAGGCACTATCAGCTCTCACTCAGGCCGTCGATGCGAAAGGGCGGCA
GATAGAGGTGGTGAAGATCCACGTGCCAGGGCCTCTGTACATCACGAAGGAAGAGGGGGAAGGTGTTCTTGCAACGGGGCATGCTGTACCGAGGGTACCA
GGCAAGAGATTGGCCGCCTCATATGTGAACTTCTACCCAGCGAATGGCGGGATCATAGCGCCGGCTTTTGGCGATAAGAAGCGGGATGACGAAGCGTGCG
AGGTTCTTCAGAAGGCATTTCCTGATCGTGAGGTTGTGATGGTGGAAGGCGCAAGGGAGATCGTGCTGGGAGGTGGGAACATACACTGCATCACGCAGCA
GCAGCCGGTGCGCCCGTCATAGATGAGCGGCGAGGAAAGGCGACCAAGCCCTGCATTGGGGTGATGATTCAACCATATTGGTTACGCCCGCAGCATATCG
GTTGCACTTTGAAACCGTGTCGCGGGCCAATAGATGCATCTCATTTGGAGATTACTGAATAATATTGTAGGTGTGTTCAGACTGTATCTTTCGCATTTGC
ATTCGCATTCGCATTCCTGGAATTTTTTGTGCTTGCCCCATGGAAAGGACT
page-top