Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_PCDAM_all.Contig217
Contig Information
Length 244 bp
Tissue Anther at meiosis
Clones 2 Clones [Download: CSV  ,  FASTA ]
whpc10g22    rwhpc10g22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit phospholipase C, phosphocholine-specific [Burkholderia cenocepacia MC0-3] >gi|169819286|gb|ACA93868.1| phospholipase C, phosphocholine-specific [Burkholderia cenocepacia MC0-3]
Score 75
Evalue 5.99562
Total Hit Count 2
Registered year 2003
Contig Sequence     [ Download ]
>Wh_PCDAM_all.Contig217
CACCATGCCCAGCCTGCAGCTGAAGGACTGATCGACGGTTTACCAGCACCAAAGCGGTTAAATAAGGCTAGTAAGTTCGTGTCTCCGTATGCAGACACCA
GTACATTGTATGGAGTGTTCAAAAAAGACCATAGATTCTTTTCTTTTTGTGGGATTAAATAAGGCTGATGATTCTGTGTGTATACAAATTCCTATAATCC
CAATGGTAACGTGCGGGTATCCGCTAGCAAAGGTAAAAAAAAAA
page-top