Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_PCDAM_all.Contig198
Contig Information
Length 596 bp
Tissue Anther at meiosis
Clones 2 Clones [Download: CSV  ,  FASTA ]
whpc10h06    rwhpc10h06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os08g0108700 [Oryza sativa (japonica cultivar-group)] >gi|113622775|dbj|BAF22720.1| Os08g0108700 [Oryza sativa (japonica cultivar-group)]
Score 170
Evalue 6.29797e-12
Total Hit Count 16
Registered year 2003
Contig Sequence     [ Download ]
>Wh_PCDAM_all.Contig198
GTCATACAATCCTACACCGGCAGAGCCAAGCTATAAATGCTGCTCTTTCTCCGCGGTGGCCTGGGGCGCAGGTGATGTGCCTGGCTGCCCGCCCATGCCG
GCTTGTGGCTCCATGGTGAGATCGATCTGTGCGCCAAGTCGGCAGTTCCCGCTTGGTGGCCTGTCACAGTGGATTTTAGCCTTTCCAGCTGGTGCTTTAC
CTATATATTAACAATCATGAACTGCATCAGGAAACACATATCTTCAGTGCAATGCGGTGACTGTTTCATTAAGAATATGTGCATGTGCATAATCGGGAAC
ACCGACCAAAATGGCATTTATCTCCTCTAGCAGAGGTTGTGCAATGGAGACCAAGACCATGACATCTTCACCAAAATACCCAGGATCCTGGCAGCTCCCC
ATCAGCAACTGAATGAAGATGTCTCTTTCCGGAATAAGACACAATGCTACCTGAAAGTTTGCAACTATGCTCGCGACATTAGTTCAGTGGACACAACTCA
AACCAGCTAATGGCTGCAATAACAGCTTGATATTACTAATGTATTGCCATTTATCAAAAGTAATGAACTAGATTTATCAGGTGAACAAAAAAAAAA
page-top