Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_PCDAM_all.Contig178
Contig Information
Length 289 bp
Tissue Anther at meiosis
Clones 2 Clones [Download: CSV  ,  FASTA ]
whpc10h07    rwhpc10h07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit chloroplast oxygen-evolving enhancer protein 1 [Leymus chinensis]
Score 239
Evalue 5.87037e-19
Total Hit Count 150
Registered year 2003
Contig Sequence     [ Download ]
>Wh_PCDAM_all.Contig178
GCTCAGCGTGACCAAGAGCAAGCCGGAGACCGGCGAGGTGATCGGCGTCTTCGAGAGCGTGCAGCCGTCAGACACCGACCTCGGCGCCAAGGCGCCCAAG
GATGTCAAGATCCAGGGTGTGTGGTACGCGCAGCTCGAGTCTAACTAGAGCAGAGCAGAAGTGAAGATGCTCATCTTGTGTGCATGCGTACGTGGGTTGA
TCGTTGGAGAGGAAACAATCGAGGCAAACAATGTGTGTTTGTGTGTGTATCTAGTAATCTAAACCCAGGGTGTCGTTTTAAAAAAAAAA
page-top