Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_PCDAM_all.Contig33
Contig Information
Length 860 bp
Tissue Anther at meiosis
Clones 2 Clones [Download: CSV  ,  FASTA ]
whpc10h16    whpc15e15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays]
Score 1228
Evalue 4.56764e-133
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_PCDAM_all.Contig33
CTCCTCCTCACCCGCCGCCGCTTCTTCTCCTCCGGAAGAAAACCCTAGAGAGCTTCAAGTTCTCCGGAGCGCGAGAGATGGCCGCGAAGGGCGATGGGCC
GGCGATCGGCATCGACCTCGGCACGACGTACTCGTGCGTCGGCGTGTGGCAGCACGACAGAGTCGAAATCATTGCCAATGACCAGGGCAACCGCACCACG
CCGTCGTACGTCGCCTTCACCGACTCCGAGCGCCTCATCGGTGACGCCGCCAAGAACCAGGTGGCCATGAACCCCATCAACACCGTCTTCGATGCCAAGC
GTCTCATTGGCCGGAGATTTACCGATTCTACTGTCCAGAGTGATATTAAGCTGTGGCCCTTCAAGGTTGTTGCTGGACCTGGTGACAAGCCTATGATTAA
TGTCCAGTACAAGGGTGAGGAGAAGCAGTTTGCAGCCGAGGAGATATCTTCTATGGTTCTCATCAAGATGCGTGAGATTGCTGAAGCTTTCCTTGGCAGC
ACTGTGAAGAATGCTGTTGTCACTGTACCTGCATACTTCAATGACTCGCAGAGGCAGGCTACCAAGGATGCTGGTGTCATTGCTGGCATCAATGTCCTTC
GTATCATCAACGAGCCAACAGCTGCTGCCATTGCTTATGGTCTTGACAAGAAGGCTTCCAGTGTTGGTGAGAAGAATGTCCTCATCTTTGATCTTGGAGG
TGGTACCTTTGATGTCTCTCTTCTCACCATTGAGGAGGGTATCTTTGAGGTTAAAGCCACAGCTGGTGACACTCATCTTGGTGGTGAGGACTTTGACAAC
AGGATGGTCAACCACTTCGTCTTGGAGTTCNAAGAGGAAGAACAAGAAAGGACATCAGTG
page-top