Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_PCDAM_all.Contig3
Contig Information
Length 737 bp
Tissue Anther at meiosis
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhpc17b24   
Homology (BLAST) Top Hit hypothetical protein OsJ_024137 [Oryza sativa (japonica cultivar-group)]
Score 491
Evalue 9.90904e-48
Total Hit Count 153
Registered year 2003
Contig Sequence     [ Download ]
>Wh_PCDAM_all.Contig3
TATCANCATGGTGCTTNCATGCCAAAACTTCTCTCGGGCTTCGGGCACCGGTCATCATCATTTGCTACTTCTCTTTACATCGGAACTATGGAGGCGAATA
ACACAGAACCATAACCTAAACAAAACGCTAGGACAAAGCACATTTCAGATGTTTCTGGNAAGGGCATAAGGCTCCTGTCATGCCGCCTTATTGGTTTGGC
TTCAGGGCGGCATTCGGCCCCAGTCCAAGCCATGGCTGGTTCTCAAACTCCTTCTTGACTGGTGTTGCATCAGAANGAGAAGCTTGATATGGTGCCTTTG
CATGCANACGATCCTTTCTCTTCTCAAGGAATCNGTGAAGTGACGCCTTTCTAGCAATTGGCAGATCANAAGCATTCGGACGANCAGACTTANGAGCAAC
AACCGGATCACTAGGCAAACTACTTGCCGGGGCCAGCACGGCCGTCTGGACCTTGGCGGTGTCTGCAGCAGTTGTGGTCNCANAGACGTTCTGAGCAACC
GGGCTGCCCTTGCCAGCCAACTGCATCAGGCCCTTGGCCTTGTCGGCTGGGAAATCGTTGAACACGAGCACCTTCCCACCATAAAAGATGGTCAGCTGGC
TCTTGTCTTCCTCCCTANTANCGNCAGGGGCGGCGGCGTCCTGCAGGCCGGCGCTCTGCNGAAANAGCTCCATGGTCTCCTTCTTCCTGCCGGCCTCCTC
GCCCTCCGCCCCANGCAAANGGCTCTTGGTGTCCNCC
page-top