Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig2547
Contig Information
Length 2091 bp
Tissue Seed DPA5
Clones 41 Clones [Download: CSV  ,  FASTA ]
whok18g19    whok19b20    whok10c23    whok1a10    whok4k22    whok4n08    whok5a14    whok5k12    whok7a23    whok7b10    whok7k20    whok7l07    whok7l08    whok7m20    whok8f24    whok8m24    whok13p14    whok14h21    whok17g14    whok20p14    rwhok10c23    rwhok1a10    rwhok17g14    rwhok17n19    rwhok18g19    rwhok4k22    rwhok4n08    rwhok5a14    rwhok5j16    rwhok7a23    rwhok7k20    rwhok7l07    rwhok7l08    rwhok7m20    rwhok8f24    rwhok8m24    rwhok9e11    rwhok13p14    rwhok14h21    rwhok14j09    rwhok20p14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit S-adenosylmethionine decarboxylase precursor [Triticum aestivum]
Score 2003
Evalue 0
Total Hit Count 363
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig2547
GAGTACACCAATTACAGAAGAGTGCTGCTATGCACACGACATGTTCCAGCCGATTGTTGGACGATACTGCAATTCAGGCCATCGATACCTAGTACTAGGT
GCAACACAGCCACTAGATTAAGAATCGTGCTTGAATCGTCCAACAGCTATCGGCTGTGAAGTAGTTTCGATTACAGAACATGAATATGATAACAAAGTGA
CACTCGTCTTAGAAAAAAAATGCTTATTTATCAGTTTGAGACAACTTCTCCCCAGAAGTACGCTTCATTGTGGCAGACGCAGCAAACCACCTAGAGCTAA
TAGTTTATTCGGAGTAGCAATAGCCTGGCCAGCTGCTTCACAGTAACCAAACGACAAACTTAGTCAGAACAAAGTCCACAGACGGAACAGCGACAGCCAA
TCACTCGCACAGCACCGCGCCCTCCTCCAGGGAATCCTCCTCCGCCCGCCATGCGAGGAGGTTGGCGAGCTTGCCTTCCTTGACCAGAGGGTGGCTCTGC
ACACTCTCGGCCTCGAAGCAGTGGAAGACGGACCTGGGCGACCCGGCAGAGACAGCAACCTCTTCGTTCGCGGCAAAGCTCTGGTAGATGAGGACGCCCC
CGCAGGGGAGCTCCTGCTCCACAACGTTGTTGCAGTCGTATGCCTCAGCTTCGAGCTTCTTGCCCCAGGTGGCGGCGTGGCCACGGCCACCGAAGATGGT
GACCGCCACAGAGAACTCTGAAGGGCCAAAGCACCGGAGGACCCTCTTGACGATGTCGCCGTAGGCCAGGGCGGAGGCGTCCATGCCCATGACCTCGTAG
CTCGCGTAGCTGAAGCCGTCCTCGGGGGTCACATGGATGGTGGAGACGGCAGATCCGTTGATGGCGTTCATGGAGTAGCCGCAGGGCTCGAAGTCGAAGT
CACAGACCTCCATCTCAGGGATAATGTCAGAGATTCCAGAGAGCTTGGTCATCTCCTTGGCACAGGAAACGTGGCCATCAGCTTGAGTCTTGAAGAAGAC
AGAGGCCTTCTTCTTGTCCAGCCCAGTCATGCACATCTCCAGGGTGACCATGGGCTGCTCAGGTTGCTCGGTGGCATAGTAGATGTGCCACTTCTGGCCA
GGCTTCGCTGGGTCTCCGATCACATAAGCATTGCCACCAGACTTCAGGTGGCCGAAGTAGCGGTTCAGGACATCAACCTCCTCAGAGAAGCTCCTGTGGG
GAGCAGGCTGTGCGCCGGGGAAGATGAACATCCCACGAGAGTACTTGACGGCAGCAAGCGGCATGCACAGCTCTTCAGCAAGCTCAAGAATCCTAGGAAT
GGTGAGCAGGAGCATGGTAGTCCCACAGGTCTTGATCACAATCTTCTGAGAATAGATGAACAGGCTGGACTCAGATAGCACATACGAGTCGAAGTCCTTG
TTGGAGAGCTCGGACACAATGGTGCACCGTGCAAGATCAAGAACAGAGTCAATCTGGGCCCTAGAGAGGGCGCGCAGGCCACGACCATGAGGGTCGGCAA
AGATCGATGCCTCGGAGAAGGTGATCTCGAGGCGCTTCTCGTAGCCCTCGAACCCGATTGCAGAGGTCGGGGCAGCCATTGTTGCAGTTTGAGTCAGAAA
GCAGAGCAGAGAGGAACAGAGGGAGTAAGACTAGAGAACTGGTCGATTATCGTGAAGCAGGCCAGAGAGATTGGTGGGAGAAAAGAGTCAGAATAAAATT
GCATAAAAATCCTAAACTACGGGAAGGGGATGCCAAAAACGATATCAGGATGGCTTCTTCGCGCAGTTCGAGTATGCAGCAGAGAACTTCTTGGCGCCTC
CAGCAGGTCGAACGTCTTCAATGCTGTAGCCGAGGGGAGCTTCGTACATCAGGGAACTACTACTGCTAGACTTTTTGCCACCCTTTGACTCCATTAGCAC
ATTCACTAAAGGTTCCTGGGAAAAATTGTATGGTAACCCCGATCCCGAGCGCGCCCGCTTGTTCCGATTCCGATCTCAAGAATTCCCCCTCTCCCGACAC
AGATCTCGAGCACTCCCAACGAGTTCTGCTCTCTCTTTTTTTCTTATCTAGCTGTGGTGGCGGCGGCGAGATCGGTGGGGGTGGGAGGAAT
page-top