Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig2546
Contig Information
Length 1935 bp
Tissue Seed DPA5
Clones 34 Clones [Download: CSV  ,  FASTA ]
whok18p15    whok18p21    whok18p22    whok19m11    whok10c05    whok10p11    whok12k03    whok12p21    whok3d02    whok3e18    whok4h04    whok4l10    whok5l18    whok6g06    whok7j01    whok14a11    whok17g23    rwhok10c05    rwhok10p11    rwhok12k03    rwhok3d02    rwhok3e18    rwhok12p21    rwhok17g23    rwhok4h04    rwhok4l10    rwhok5l18    rwhok6g06    rwhok7j01    rwhok14a11    rwhok18p15    rwhok18p21    rwhok18p22    rwhok19m11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit S-adenosylmethionine decarboxylase [Triticum monococcum]
Score 1360
Evalue 0
Total Hit Count 373
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig2546
TGAATATGATACAGGCAGAAAGGAATTCAGTAGTAATAACAAAGTGACACTCGTCCTAGAAAAAAAATGCTTATTTATAAGTTGAGACAACTTTTCCCCA
AACAGTATGCTCATTGTGGCAGACGCAGCAAACCACCTAGAGCTAATAGTTTATTCAGAGAGCAATAGCCTGGCCGGCTGCTTCACAGTAACCAAACGAC
AAAAGACATACAGTCAGAGCAAATTCCACAGACTGAACATTCGACAGCAAATCACTCGCACAGCACCACGCCCTCCTCCAGAGAATCCTCCGCTCGCCAT
GCGAGGAGGTTGGCGAGCTTGCCTTCCTTGACCAGCGGGTGGCTCTCCACAGTCTCGGCCTCGAAGCAGTGGAAGACGGACCTGGGCGACCCGGCAGAGA
CAGCAACCTCTTCGTTCGCGGCAAAGCTCTGGTAGATGAGGACGCCTCCACAGGGGAGCTCCTGCTCCACAACGTTGTTGCAGTCGTATGCCTCGGCGTC
GAGCTTCTTGCCCCAGGTGGCGGCATGGCCGCGGCCACCGAAGATGGTGACCGCCACTGAGAACTCTGAAGGGCCAAAGCACCGGAGGACCCTCTTGACG
ATGTCGCCATAGGCCAGGGCCGAAGCGTCCATGCCCATGACCTCGTAGCTCGCGTAACTGAAGCCGTCCTCGGGGGTCACATGGATGGTGGAGAAGGCAG
ATCCGTTGATGGCGTTCATGGAGTAGCCGCAGGGCTCGAAGTCGAAGTCGCAGACCTCCATCTCAGGGATGATGTCAGAGATACCAGAGAGCTTGGTCAT
CTCCTTAGCACAGGAGACATGGCCATCAGCAGAAGTCTTGAAGAACACAGAGGCCTTCTTCTTGTCGAGCCCAGTCATGCACATCTCCAGGGTGACCATG
GGCTGCTCAGGTTGCTCGGTGGCATAGTAGATGTGCCACTTCTGGCCAGGCTTCGCTGGGTCTCCAATCACATAGGCATTGCCACCAGACTTCAGGTGGC
CAAAGTAGCGGTTCAGGACATCAACCTCCTCAGAGAAGCTCCTGTGGGGAGCAGGGCTGTGCACCGGGGAAGATGAACATCCCACGGGAGTACTTCACAG
CAGCAAGCGGCATGCACAGCTCTTCAGCCCAGCTCGAGAATCCTTGGAATGGTGAGCAGGAGCATGGTAGTCCCACAGGTCTTGATCACAATCTTCTGAG
AGTAGATAAACAAGCTCGACTCGGATAGCACGTACGAGTCAAAGTCCTTGTTGGAGAGCTCGGACACAATGGTGCACCGTGCAAGATCAAGAACAGAGTC
AATCTGGGCCCTGGAGAGGGCGCGCAGGCCACGACCATGAGGGTCAGCAAAGATTGATGCCTCAGAGAAGGTGATCTCAAGGCGCTTCTCGTAGCCCTCA
AATCCGATCGCAGAGGTCGGGGCAGCCATTGTTGCAGTTTTGAGTCAGAAAGCAGAGCAGAGAGGAACAGATGAAGCAGCAAGCCAGAGAGATTGGTGGG
AGAAAAGAGTCAGAATAAAATTGCATAAAAATCCTAAACTACGGGAAGGGGATGCCAAAAACGATATCAGGATGGCTTCTTCGCGCAGTTCGAGTATGCA
GCAGAGAACTTCTTGGCGCCTCCAGCAGGTCGAACGTCTTCAATGCTGTAGCCGAGGGGAGCTTCGTACATCAGGGAACTACTACTGCTAGACTTTTTGC
CACCCTTTGACTCCATTAGCACATTCACTAAAGGTTCCTGGGAAAAATTGTATGGTAACCCCGATCCCGAGCGCGCCCGCTTGTTCCGATTCCGACCTCA
AGAATTCCCCTCTCCCAACACAGATCTCGAGCCCTCCCGACGAGTTCTTCTCTCTCTTTTTTTCTCTTATCTAGCTGCGGTGGTGACGGCGGCGAGACGG
CGAGGGTGGGAGGAATTCTTGTGCAACGAGTAGCC
page-top