Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig2522
Contig Information
Length 1541 bp
Tissue Seed DPA5
Clones 17 Clones [Download: CSV  ,  FASTA ]
whok19p08    whok10d10    whok10j18    whok11d04    whok1j07    whok2l13    whok2n20    whok7c14    rwhok10d10    rwhok10j18    rwhok1j07    rwhok2l13    rwhok2n20    rwhok18n07    rwhok7c14    rwhok19i24    rwhok19p08   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit elongation factor 1-alpha [Zea mays] >gi|2282584|gb|AAB64207.1| elongation factor 1-alpha [Zea mays] >gi|195622218|gb|ACG32939.1| elongation factor 1-alpha [Zea mays]
Score 1172
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig2522
TCACAATCAGTCTCAGGGGCACAGGGAGTTTAGCCGACGCAGGAATAGAAATACAGTAATTAAACGACAGACAGATCATTGCTCGCTCGGGATAAGAGTC
TGAAGCAACAAAAGCAATGACCGTGAACAAAAACATTCTGCTAGATAGCACGCCTATTTCTTCTTGATGGCAGCCTTGGTAACCTTGGCGCCGGTGGGGT
CCTTCTTCTCCACGCCCTTGATGACACCAACAGCAACCGTTTGTCTCATGTCACGCACAGCGAAGCGGCCAAGAGGAGGGTAGGTGGCGAAGGTCTCCAC
AACCATGGGCTTGGTGGGAATCATCTTGACGATACCAGCGTCACCGTTCTTCAGGAACTTGGGCAGCGCCTCCAGCTCCTTACCAGATCGCCTGTCGATC
TTGGTCACCAGCTCAGCAAACTTGACAGCAATGTGGGAGGTGTGGCAGTCCAGCACTGGGGCGTAGCCATTGCCGATCTGACCAGGGTGGTTCATGATGA
TGACCTGGGAGGTGAAGTTGGCCGCCTCCTTGGCAGGGTCATCCTTGGAGTTGGATGCAACAAACCCACGCTTCAGATCCTTCACAGCAACGTTCTTGAC
GTTGAAGCCAACGTTGTCACCAGGAAGCGCCTCCAGGAGAGACTCATGGTGCATCTCAACAGACTTAACCTCAGTTGTCAGACCAGTGGGACCAAAGGTA
ACAACCATACCAGGCTTGATGACACCAGTCTCAACACGGCCAACAGGCACAGTTCCAATGCCACCAATCTTGTAAACATCCTGAAGGGGAAGACGCAGGG
GCTTGTCTGAGGGCCTCTTGGGGCTCATTGATCTGGTCAAGAGCCTCAAGAAGGGTAGGGCCCTTGTACCAGTCAAGGTTGGTGGACCTCTCAATCATGT
TGTCACCCTCAAACCCAGAGATGGGAACGAAGGGAACCTTGTCAGGGTTGTAGCCGACCTTCTTCAGGTACGAAGAGACTTCCTTGACAATTTCCTCATA
ACGGGCCTTTGAGTACTTGGGAGTGGTGGCGTCCATCTTGTTGCAGCAGCAGATCATCTGCTTCACTCCAAGGGTGAAAGCAAGGAGGGCGTGCTCACGG
GTCTGGCCATCCTTGGAGATACCAGCCTCAAAACCACCAGTGGTGGAGTCAATGATGAGCACAGCACAGTCAGCCTGGGAGGTACCAGTAATCATGTTCT
TGATGAAGTCACGGTGACCAGGGGCATCAATGACGGTGCAGTAGTACTTGGTGGTCTCGAACTTCCACAGGGCAATATCAATGGTGATACCCCTCTCACG
CTCGGCCTTCAGCTTGTCAAGCACCCAGGCGTACTTGAAAGACCTCTTGTTCATCTCAGCGGCTTCCTTCTCAAACCTCTCGATCACACGCTTGTCAATA
CCTCCAAGCTTGTAGATCAGATGGCCAGTGGTTGTCGACTTGCCAGAGTCGACATGGCCAATGACCACGATGTTGATGTGAGTCTTCTCCTTACCCATGG
CTGGAGCTCCGAGGAAGGAGAAGGAACCGAGAGGAGGCGGC
page-top