Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig2511
Contig Information
Length 1650 bp
Tissue Seed DPA5
Clones 15 Clones [Download: CSV  ,  FASTA ]
whok18k24    whok10k12    whok11h19    whok11l10    whok8d23    whok13m15    whok14n19    whok16i23    rwhok11h19    rwhok11l10    rwhok18k24    rwhok8d23    rwhok13m15    rwhok14n19    rwhok19e24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit elongation factor 1 alpha [Actinidia deliciosa]
Score 1094
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig2511
TCCCTCCGTTCGTTCTTCTTCTTCGAGTTGGGTAGTTTAGCTCTACCCACCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCAC
GGTCGACTCTGGCAAGTCGACGACCACTGGCCACCTGATCTACAAGCTTGGAGGCATTGACAAGCGTGTCATCGAGAGGTTCGAGAAGGAAGCCGCTGAA
ATGAACAAGAGGTCTTTCAAGTACGCCTGGGTGCTTGACAAGCTCAAGGCCGAGCGTGAGAGAGGTATCACCATCGATATTGCTCTCTGGAAGTTTGAGA
CCACCAAGTACTACTGCACCGTCATTGATGCCCCTGGTCACCGTGACTTCATCAAGAACATGATCACCGGTACCTCCCAGGCTGACTGTGCTGTTCTCAT
CATCGACTCCACCACTGGTGGTTTTGAGGCTGGTATCTCCAAGGATGGCCAGACACGTGAGCACGCCCTCCTTGCTTTCACTCTTGGAGTGAAGCAGATG
ATCTGCTGCTGCAACAAGATGGACGCCACCACTCCCAAGTACTCGAAGGCTCGTTACGAAGAAATTGTTAAGGAGGTCTCTTCGTACCTGAAGAAGGTCG
GCTACAACCCTGACAAGGTTCCCTTCGTCCCCATCTCTGGGTTCGAGGGTGACAACATGATTGAGAGGTCCACCAACCTTGACTGGTACAAGGGCCCAAC
CCTGCTTGAGGCACTTGACCAGATCAACGAGCCCCAAGAGGCCCTCAGACAAGCCCCTCCGTCTTCCCCTACAGGATGTTTACAAGATTGGTGGCATTGG
AACTGTGCCTGTTGGCCGTGTTGAGACTGGTGTCATCAAGCCTGGTATGGTTGTTACCTTTGGTCCCACTGGTCTGACAACTGAGGTCAAGTCCGTTGAG
ATGCACCATGAGTCTCTCCTGGAGGCGCTTCCTGGTGACAACGTTGGCTTCAACGTCAAGAACGTTGCCGTGAAGGATCTGAAGCGTGGGTTTGTTGCAT
CCAACTCCAAGGATGACCCTGCCAAGGAGGCAGCCAACTTCACCTCCCAGGTCATCATCATGAACCACCCTGGTCAGATTGGCAACGGCTACGCCCCAGT
GCTGGACTGCCACACCTCACACATTGCTGTCAAGTTTGCTGAGCTGGTGACCAAGATCGACAGGCGGTCTGGTAAGGAGCTGGAGGCCCTGCCCAAGTTC
CTCAAGAATGGTGATGCTGGCATAGTGAAGATGATTCCCACCAAGCCCATGGTTGTGGAGACCTTTGCCACTTACCCTCCTCTTGGTCGTTTTGCTGTCC
GTGACATGAGGCAGACTGTGGCTGTTGGTGTCATCAAGGGCGTTGAGAAGAAGGACCCAACCGGGGCCAAGGTGACCAAGGCTGCCATCAAGAAGAAGTA
ATTCCACAATTGATATCCAAATCACTGTTTCAGACACCAAGCAGTTTTTAGTATTGGCTGAGTTTTGTTAAGGGCATTGTTCGTACTGGGTATATTTTAG
CTGTTCAGCTGTTAGCGCTGCATATCGTGCCCTTGGTGGTGTCTGTCTTGTGCCTTACATACTGTCCTAATGTAAGCTTTGGTGAAACCTGGATGTTATG
AGACCTGGTTTGTGTCTTTTAATACTAGCTTGTTGCATTTAAAAAAAAAA
page-top