Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig2509
Contig Information
Length 1903 bp
Tissue Seed DPA5
Clones 15 Clones [Download: CSV  ,  FASTA ]
whok10a11    whok11f05    whok4m05    whok8o09    whok9k11    whok14g10    whok15o23    rwhok10a11    rwhok10l01    rwhok11f05    rwhok15o23    rwhok4m05    rwhok9a05    rwhok9k11    rwhok14g10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_28114 [Oryza sativa Indica Group]
Score 668
Evalue 1.21874e-67
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig2509
TATATAGTAGAATTCTGGCATTACAACATATAGCGGCAAGAAAATACTACAGACAAATGATACTAGGTCCACTAGGACAATGGGAAACACGGGGATACAG
TCGTCTAGACACGCGGCAGTTGCATCAGACCATTTTGTGGCTCAAACAGTTTCTAATCGTCACCAAACGTGGTCTTCTTCCCGGCGCTAGCTGTGCCAGC
ACTCTGTCTGCTCTGAAAGCCTCGGCCGCCTCCTCTGCCGCCATCACGGCCACCAGACCGGCCAAACCTGCCGCCACCATCACGGCCACCAGACCGGCCA
AACCTGCCACCGCCATCACGACCACCAGACCGGCCGAACCTGCCACCGCCAGAGCGGCCACCATCTCTGCCACCAGATCGACCACCAACGCCACCAAATT
GACCCTTAGGCTTAGCTTCAGCAACATACAAGTTGCAGCCACCTAGGTCAGATCCACTAAGCGCAAGTGCTTTCGAAAAGGAACTCTCATCAGTAAAATC
CATGTAAGCTATCCCTTTGCTTGCACCATTCTCATAATCCATCGGAACTGAGACACGTGTGATTTCTCCACATTTAGAGAAGTGTTCTTGAAGAGAGCTC
CGAATAGCATCCTCCTGTTGAGATGAATCAAAACCCTTGACAAATACTGAGAGGCTGGGACCTCCACTTGGTTTTCCAAAAGATCCACCATCCCTGGTGC
GAGGAGCGCTCGCACCTCTTTCAGCAGCCATGTCAAGTCTCACAGGACGGCCCATTAGATCTCCACCATTCAACGAATCAAGCGCCTTCTGAGCATCTTC
AGCCGTAGCAAACTCAACATGACCAAATCCCTTGGGATGGCCATCTTCATGGGTAGCCAGGCGAACATCAACGACCTCTCCAATTTGTGCAAAAAATTGC
TTCACTTGATCATACTCAATATTGAAGGAAAGGTTCCCCATCCAAAGGGTCTTCGACCCTGTTGCCTGACCTTTGTTGCTAGCAGGAGTATTAGGCTCTT
CCTTCTGTGATTTTGTGGCAGTTGTAACTTCCTTTTTAGGCTCATCATCAGAGCTTTCATCAGAACTGTCATCATCACTGGTGCTGTCCTTTTTGGCAGA
CTTAGGAGCAACCTTCGCAGCATCCTTCTGCTTTTTCTGGGGAGGCTCTTCATCACTCTCATCACTGTCTGAGGAATCACTGGACTCCTCCTTCCTTTTA
GCAGCTGCAGGAGCTATCTTGGTGGCCTGTGCGGCTTTCTTTGATTTCTCCTCATCCTCAGATTCACTCTCCGACTCAGAACTGTCTGAAGAATCTACCT
TCTTGGCAGCAGCAGCAGGAGTCTTGGCAGGAACATCCTCATCTGAGCTATCATCTGAGTCACTCTCGGAGCTGTCAGATTCGATGACTGGTGTTCTCTT
TACCAGAGCAGCAGGTTTCTCGTCATCATCGGACTCATCCTCAGAACTGGAAGAGCTGCTCTCAGGCTTGCCTTTCTTCGAGCCGTTGCTGGCAGCTGGG
GTCACAGGTTTAGCAGAAGGCTTCTTTGCAGGTTCCTCGTCAAAGGAGGAATCGTCGCTGCTATCATCTGAAGACTCGTGTTTGACAGGCTTTGCAGTCT
TCTTAGGAACCTCCTCCTCCTCGGACTCGGATGACTCCTCCTCGGAGCTGCTGCTCTCAACCTTCTTGGGCGGCGGCTGCTTCTTGGCCTTCTTGGCGGC
CTCTTTGGGCCCGGGCACCGCCTTTGCCGGCGCAGCCTTCTGTTTCTTTGCGCTTACAGCCTTCTCGATCTCGTCATCGGCTTCGCGCTTCTTCCCGGCC
TTCCCCTTGGTAAGGACGGCCGCCGGCGCCACGACAGTAGGGGCCGCGGACTTCTTGCTTGACTTGCCCATGGACCGCTGGCGGCGTAGAGGCAAGGAGG
GAG
page-top