Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig2490
Contig Information
Length 1545 bp
Tissue Seed DPA5
Clones 13 Clones [Download: CSV  ,  FASTA ]
whok10d06    whok2b04    whok3b04    whok5b15    whok6b19    whok7j10    whok17b13    rwhok10d06    rwhok2b04    rwhok3b04    rwhok17b13    rwhok5b15    rwhok7j10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Elongation factor 1-alpha; Short=EF-1-alpha >gi|170776|gb|AAA34306.1| translation elongation factor 1 alpha-subunit >gi|949878|emb|CAA90651.1| elongation factor 1-alpha [Hordeum vulgare subsp. vulgare]
Score 2273
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig2490
CCGCCGCCGCCTCCTCTCGGCTCCTTCTTCCTTCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCCG
GCAAGTCGACCACCACTGGCCATCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAAGCCGCTGAGATGAACAAGCG
GTCGTTCAAGTACGCCTGGGTGCTTGACAAGCTGAAGGCCGAGCGTGAGAGGGGTATCACCATTGATATTGCCCTGTGGAAGTTCGAGACCACCAAGTAC
TACTGCACCGTCATTGATGCCCCTGGTCACCGTGACTTCATCAAGAACATGATTACTGGTACCTCCCAGGCTGACTGTGCTGTGCTCATCATTGACTCCA
CCACTGGTGGTTTTGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCACGCCCTCCTTGCTTTCACTCTTGGAGTGAAGCAGATGATCTGCTGCTG
CAACAAGATGGATGCCACCACTCCTAAGTACTCGAAGGCTCGTTATGAGGAAATTGTCAAGGAAGTCTCTTCGTACCTGAAGAAGGTTGGCTACAACCCT
GACAAGGTTCCCTTCGTCCCCATCTCTGGGTTTGAGGGTGACAACATGATTGAGAGGTCCACCAACCTTGACTGGTACAAGGGCCCTACCCTTCTTGAGG
CTCTTGACCAGATCAACGAGCCCAAGAGGCCCTCAGACAAGCCCCTGCGTCTTCCCCTTCAGGATGTTTACAAGATTGGTGGCATTGGAACTGTGCCTGT
TGGCCGTGTTGAGACTGGTGTCATCAAGCCTGGTATGGTTGTTACCTTTGGTCCCACTGGTCTGACAACTGAGGTCAAGTCTGTTGAGATGCACCACGAG
TCTCTGCTGGAGGCGCTTCCTGGTGACAACGTCGGCTTCAATGTCAAGAACGTTGCTGTTAAGGATCTGAAGCGTGGGTTTGTTGCATCCAACTCCAAGG
ATGACCCTGCCAAGGAGGCGGCCAACTTCACCTCCCAGGTCATCATCATGAACCACCCTGGTCAGATCGGTAACGGCTATGCCCCAGTGCTGGACTGCCA
CACCTCCCACATTGCTGTCAAGTTTGCTGAGCTGGTGACCAAGATCGACAGGCGATCTGGTAAGGAGCTGGAGGCGCTGCCCAAGTTCCTCAAGAATGGT
GACGCCGGTATCGTGAAGATGATTCCCACCAAGCCCATGGTTGTGGAGACCTTCGCCACCTACCCTCCTCTTGGCCGCTTTGCTGTGCGTGATATGAGAC
AAACGGTTGCTGTTGGTGTCATCAAGGGCGTGGAGAAGAAGGACCCCACCGGTGCCAAGGTTACCAAGGCTGCCATCAAGAAGAAATGAGTGCTCTGGTG
TCTGCCATCGAGTTATCTAGCAGAAGTTTTAGTGTCAAGTCTTTTTTGGAGAATCTTAGTGTATGTTAAGTGTTATTCCTGGGGCGTTGTTGCCACTTTG
ACTCCTGCACCTGTGTGCGAGCTATGATGTGTCGTTTAAATACTC
page-top