Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig2483
Contig Information
Length 1068 bp
Tissue Seed DPA5
Clones 12 Clones [Download: CSV  ,  FASTA ]
whok19m23    whok10c12    whok12f11    whok3d10    whok13d08    whok13d19    rwhok10c12    rwhok12f11    rwhok3d10    rwhok13d08    rwhok13d19    rwhok19m23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0197600 [Oryza sativa (japonica cultivar-group)] >gi|49388156|dbj|BAD25284.1| putative chlorophyll a/b-binding protein type III precursor [Oryza sativa Japonica Group] >gi|49388341|dbj|BAD25451.1| putative chlorophyll a/b-binding protein type III precursor [Oryza sativa Japonica Group] >gi|113535731|dbj|BAF08114.1| Os02g0197600 [Oryza sativa (japonica cultivar-group)] >gi|125538483|gb|EAY84878.1| hypothetical protein OsI_06243 [Oryza sativa Indica Group] >gi|125581168|gb|EAZ22099.1| hypothetical protein OsJ_005582 [Oryza sativa (japonica cultivar-group)] >gi|215678980|dbj|BAG96410.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215679371|dbj|BAG96511.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215686386|dbj|BAG87647.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215737482|dbj|BAG96612.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215737505|dbj|BAG96635.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215737512|dbj|BAG96642.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215737560|dbj|BAG96690.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215737570|dbj|BAG96700.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215737580|dbj|BAG96710.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215737621|dbj|BAG96751.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215737634|dbj|BAG96764.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215737653|dbj|BAG96783.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215737729|dbj|BAG96859.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215737785|dbj|BAG96915.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215765646|dbj|BAG87343.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215767462|dbj|BAG99690.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1080
Evalue 9.39273e-116
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig2483
TTTTTTTTTTGGTGAAGATGATGAGAGATGCAATGCACTAATTTTCATAGCACGATATAAATATTACAAGCATGCACGCAGCACGCGCTACAAATTTACA
TTTTACACCCACCCTCGCATATATACCTCTCGCACGCTCACGTTTCCCACGACGACGGGTACCATGCACAGGACGACGATGCTCGGATCGGATCGGATGG
ATTTCGCCTAGTGGAACTTGAGGCTGGTGAGGATGTTGTTGTTGACGGGGTCGGAGAGGTGGTCGAGGAGGTTCTGGAAGGGCCCGACGCCGGTGAAGAT
GGCCTGCAGGGACATGCCGAGGAAGGCGAGCATGGCGAGGCGGCCGTTCTTGATCTCCTTGAGCTTGAGCTCCTTCATCTCCTTCTCGCTCTTGGTGCCG
AACCCGAGCGGGTTGAAGATGGGCCCGCCGGGGTAGGCGGGGTCGCCGGAGCCACCGAGGTACTTCTCGAGGCCCAGGAAGTACTGCTTCCCCATGGAGC
CCGGGTTGTACCAGTCCTGGAGCCGCCGGTGCTCCGCGAAGCCGATGAGCGCCATCTCGAACACGAAGAGCGTGTATGGGTCGGCCCAGTACTGGTAGGT
GCCCGCCGGCGGGATCGCGCCTGCCTGGAACCACGGGATCGCCGTCTCCGGGGGCACCAGACCCACCTTGCCCAGGGCCTCCGGGGCGATCATGCCCACC
ACCCCCATCATCGCCGTCCGGCCGTTGAAGATCTCGCCGTAGGCCAGCCACCTGGGCTCGATGAACCCGCCGGTGCCCTCTGGGTCGGACAGCCCCAAGG
GGTCGAAGCCAAAGTCACCGGGCAGCGTGCCGTCGAGGTAGGTGAGGGACTGCTTGGACGCAAACCACAGCTGCCTGTTGTCATTTTGCTTGGCAGGGGG
GCTGGAAGATGCCCTGACGACGAAGGGGGACTTCCGGGAGGAAGACGACCTGGAGATGGAAGACTGCAGAGGCCTCCCCAGCAGCTGCCTCCCAGAGAGA
AGACCCTGGGCCGCCATTGTTCCTGCAAGCTCCTCCTCCTCCTGCTCCGAGAGATGAGGCAGGCGTGG
page-top