Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig2469
Contig Information
Length 2900 bp
Tissue Seed DPA5
Clones 12 Clones [Download: CSV  ,  FASTA ]
whok18n16    whok19p23    whok20f24    whok4d11    whok4i18    whok9h12    whok13b03    whok15a10    rwhok18n16    rwhok4i18    rwhok9h12    rwhok19p23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0519900 [Oryza sativa (japonica cultivar-group)] >gi|49387779|dbj|BAD26337.1| putative elongation factor 2 [Oryza sativa Japonica Group] >gi|113536503|dbj|BAF08886.1| Os02g0519900 [Oryza sativa (japonica cultivar-group)] >gi|119395216|gb|ABL74569.1| elongation factor 2 [Oryza sativa (japonica cultivar-group)] >gi|125539668|gb|EAY86063.1| hypothetical protein OsI_07431 [Oryza sativa Indica Group] >gi|125582310|gb|EAZ23241.1| hypothetical protein OsJ_006724 [Oryza sativa (japonica cultivar-group)]
Score 4102
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig2469
AGGGGGATCGCCTAGGTCCTTCTCCTGCGCCTTCGCTCGGCGCCGCCGCCTCCTCATCCTCCAGGGCTGTCCTCATCTCATTCCTCCTGACAGCGAGGGA
GATCCTCAAGGAATTTATATTTGTAGTGTGATAATCAAAAGCAGTCAAGATGGTGAAATTCACAGTAGAAGGACTCCGCATCATCATGGACAAGCAAAAT
AATATTCGCAACATGTCTGTTATTGCTCATGTGGACCATGGCAAGTCTACGCTTACTGATTCTCTGGTGGCAGCTGCTGGGATTATCGCCCAGGAAGTTG
CTGGTGATGTTCGCATGACTGATACCCGTGCAGATGAGGCAGAACGTGGTATTACAATCAAATCCACGGGTATCTCTCTTTTCTATCAGATGACTCCTGA
ATCACTTGAGATGTACAAGGGCGACAGGGATGGTGATGAGTACCTGATCAACCTTATTGATTCACCTGGCCACGTTGACTTCTCTTCAGAAGTCACAGCT
GCTCTTCGTATCACTGATGGTGCTTTGGTTGTTGTTGACTGTATTGAGGGTGTCTGTGTGCAGACTGAAACTGTGCTGCGCCAAGCTCTTGGTGAGAGGA
TTAGGCCTGTCCTCACCGTGAACAAGATGGACAGATGCTTCCTTGAGCTTCAAGTGGAAGGTGAGGAAGCATACCAGACTTTCTCCCGTGTCATTGAAAA
TGCCAATGTCATCATGGCAACATATGAAGATGTGCTCCTTGGTGATGTCCAAGTGTACCCGGAGAAGGGGACTGTTGCATTCTCTGCTGGTTTGCATGGG
TGGGCTTTCACCCTTACAAACTTTGCTAAGATGTATGCCTCCAAGTTTGGAGTTGATGAGGCGAAGATGATGGAGAGGCTTTGGGGTGAGAACTTCTTTG
ACCCAGCCACAAAGAAATGGACCTCCAAGAACACTGGGACAGCTACCTGCAAGAGAGGTTTCGTTCAGTTCTGCTACGAGCCAATCAAGCAAATCATAGC
CACCTGCATGAATGATCAGAAGGATAAGTTGTGGCCTATGTTGAAGAAGCTTGGTGTGACCATGAAGAATGATGAGAAGGACTTGATGGGCAAGGCTCTC
ATGAAGCGTGTGATGCAAACTTGGCTGCCTGCCAGTCGTGCTCTGCTTGAGATGATGATATTTCACCTTCCCTCTCCCTCAAAGGCACAGAGGTATCGTG
TGGAGAACTTGTACGAGGGTCCCCTTGATGATATATATGCTAATGCTATCAGAAACTGTGACCCTGATGGTCCTCTTATGCTGTATGTCTCCAAGATGAT
TCCAGCATCTGACAAGGGTAGATTCTTTGCCTTTGGACGTGTTTTTGCCGGGAGGGTTGCAACTGGTATGAAGGTCCGTATCATGGGTCCCAACTTTGTT
CCTGGCCAGAAGAAGGATCTATATGTGAAGAGTGTCCAGCGGACTGTTATCTGGATGGGAAAGAAGCAAGAGTCTGTTGAGGATGTTCCCTGTGGTAACA
CTGTTGCTTTGGTTGGTTTGGATCAGTTCATCACCAAGAATGCAACCCTGACAAATGAGAAGGAAGTTGATGCCTGCCCAATCAGGGCTATGAAGTTCTC
TGTGTCCCCTGTTGTGCGTGTTGCCGTTCAGTGCAAGGTGGCATCTGATCTTCCTAAGCTTGTTGAGGGTTTGAAGCGTCTGGCCAAGTCTGATCCTATG
GTTCTCTGTACCATTGAAGAGTCTGGTGAGCATATCATTGCTGGAGCTGGAGAGCTTCATCTTGAAATCTGTCTGAAGGATCTGCAGGATGACTTCATGG
GTGGTGCTGAAATTATTGTTTCCCCTCCTGTTGTTTCCTTCCGTGAGACTGTTCTGGAGAAGTCCTGCCGCACTGTCATGAGCAAGTCCCCCAACAAGCA
TAACCGTCTTTACATGGAAGCTCGCCCATTGGAGGAGGGATTGGCTGAGGCTATCGATGATGGCCGCATTGGCCCGCGTGATGATCCTAAGGTTCGCTCC
AAGATCCTGTCTGAGGAGTTTGGGTGGGACAAGGATCTCGCCAAGAAGATTTGGTGCTTTGGACCTGAGACGACTGGCCCCAACATGGTTGTTGACATGT
GTAAGGGAGTGCAGTATCTGAATGAAATCAAGGACTCTGTTGTGGCTGGGTTCCAATGGGCATCGAAAGAAGGTGCTCTGGCTGAGGAGAACATGCGTGG
CATTTGCTTTGAGGTCTGTGATGTTGTTCTGCACACTGATGCTATTCACAGGGGTGGTGGTCAGGTCATCCCAACAGCCAGGAGGGTCATTTACGCTTCT
CAGCTCACTGCCAAGCCAAGGCTGCTGGAGCCTGTGTACCTGGTTGAGATCCAGGCCCCGGAGAATGCACTTGGCGGTATCTATGGTGTTCTGAATCAGA
AGAGAGGGCACGTGTTTGAGGAGATGCAGAGGCCTGGTACCCCGCTGTACAACATCAAGGCTTACCTCCCGGTCATCGAGTCGTTTGGGTTCTCAAGTAC
CCTCAGGGCGGCGACATCTGGCCAGGCTTTCCCCCAGTGTGTGTTCGACCATTGGGACATCATGTCTTCTGATCCTTTGGAGGCCGGCTCCCAGTCCGCG
ACCCTTGTCACAGAGATCCGCAAGCGCAAGGGTCTCAAGGAACAGATGACCCCTCTATCTGATTTCGAGGACAAGCTCTAAACTTTTGCTTCTGTTACAT
GGTCTAGTTTGCTTTTGCTGCTAAGAGAGCTGCACTATTATCTGTCTATTGAGTCGTCGTCGCTGTATTGCTATTGGAATGTACTCCTATCTGTCGTGAT
ACTGGCACTTTGTTTTGATGTCTGTCGATGTTAAAACTTAGATTATATATCTGTCGTGATACTGGCACTTCGTTTTGATGTCTGTCGATGTAAAGCTAGA
page-top