Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig2462
Contig Information
Length 821 bp
Tissue Seed DPA5
Clones 11 Clones [Download: CSV  ,  FASTA ]
whok10c11    whok3m20    whok9f11    whok17a09    whok17a10    rwhok10c11    rwhok3m20    rwhok17a09    rwhok17a10    rwhok4k05    rwhok9f11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Secale cereale]
Score 928
Evalue 2.55927e-98
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig2462
TTTTTTTTTTGGTTACCATTAAAACGTATATAGTCGACATATTGTATAATATTATGCGTCCGTTCATATACATAGCCACCGATAGCATTCTCATACGAGC
ATGCTTTCTCGAGCCATGTTGGTACATGAACATGGACATACACATATTCTTAGGAACAAATAAGAAAGATAAATGGAGAAGGAAAACCCAAAGCAATGTC
AGAGTTGACAAAACTGCAATGGCACTTTATATATGGCCTGTCGTGAGTGAGCTGTTTAGGCCTTGCCGGACTCCTCGCAGCCCGGTGGCTTGAAGGCGAT
GAAGCTGACGCACTGCACCTGGCGCATGTTGTCGAATCCGATGATGCGGACATACGCGTCAGGGTACTCCTTCTTGACCTCCTCCACCTCGTTGATCACC
TGTGTGGCGTCGGTGCACCCGAACATAGGCAGCTTCCACATTGTCCAGTACCGGCCATCATAGTACCCAGGGGATGCGTTGTGCTCACGGAAGATGAACC
CAACCTTGCTGAACTCGAGGCAAGGCACCCACTTGGAGCGGATCAGGTAGTCGACCTGCTTGAGGAGGGCCTCCGTGCTGAGCGGTGGCAAGTAGGACAG
GGTCTCGAACTTCTTGATGCCCTCAATGGGCCACACCTGCATGCACCTGATCCTTCCACCGTTGCTGACGCTGCCGAGGCTAGCGCCGTTGGAGCGGCGG
CTGACGGGGAGGCCGGCGGTGGACTTGAGCCCCTGGAAAGGAGCGACGGAGGTGGCCGACGAGGCCATCACGGTGGGGGCCATGGCTGTACTATGTAGGT
ATATAGCTTGCTAGGAAGGAG
page-top