Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig2447
Contig Information
Length 1176 bp
Tissue Seed DPA5
Clones 10 Clones [Download: CSV  ,  FASTA ]
whok10e04    whok2g13    whok5j02    rwhok10e04    rwhok2g13    rwhok4e24    rwhok5j02    rwhok5j13    rwhok19g13    rwhok19h02   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit MIKC-type MADS-box transcription factor WM2 [Triticum aestivum]
Score 1257
Evalue 3.23963e-136
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig2447
ATATATAGATATATGCGAAGGAGTACCTGAGTTGCACTGAGAAAATTAAGTAGTACCATCACAATACATATGGATACATTGCACTGGTGTGGCCAAGCCT
TAATTATATGGGATAAAGTTGATTGTGCGTGTATAGAAATACACACATTCATGGAAGTTCTAGTTATATATCACGCATATATATAGCTTCAATCTCACTT
GAAGGTAAATGAGAGACGACACAGCTGTGCATGGATGCATCCATCACCTTCCAACTGAGTTGAAACTTTTTCGGTCCTCCTGCTGGGAGCAGTACTGAGG
GTGCTGCTGCATGAAGTTGAACTGCAGGAAGGTTCTCGGATCACAATGGATCATATTTTGCTCGTACTCATTCGATGTCGAAGCCGCCCCCATCATGTTC
AACGTCTGCTGTTGCCCCCTTTCAGTCTCAGCTACTTTTTCCCTCAAGAAGAAGTTGTTATTCTGCAGCTCCATTTCCCTTCTCTGCATGTACTCAATTT
CAGCGCATAGTAATTCGTTCTTTCTTGCTCTAATCTTTCCTAGGCCTTTGTCCAGCCTTCCCTCCAGCTGCTTCAGGTCTCTGTGGCTCATGGTGGCCAT
TGTATCGCCTATTAGAGTCCTGTTGGAGTTCTGCAAGGTGGTTATCTGCTGCTTCAGCTTCGCAGATTCCTGCTGGTAGTGCTGGGCATTGATCTCTGCG
ACTGTACCAGCGCTGGAGGTGTCACTTGTTGCCTTCTTGTATCTCTCAATGGTTGCTTTCACGCTGTTGTTGGAGTACTCGTAGAGGCGCCCGCGGCCGG
AGAAGACGATGAGCGCCACCTCGGCGTCGCAGAGCACCGAGAGCTCGTACGCCTTCTTCAGGAGGCCGTTGCGGCGCTTGCAGAAGGTGACCTGCCGGTT
CGTGGTGTTCTCGATGCGCTTGATCTCGATCCTCCCTCTCCCCATCTTCTCAGCAGCCCCCCCTGCCGATCCCGACCCCGACCCCGGGGACGCAGACTCC
TTCACCATTAGGCCTGTGGATGGTGCAGCCAGCTGCTCGTTGAGTATCTGCATGTTTGTGTTTCGTGGGCGGAGAGAGATGGGATGGATAGAGTGAGAGA
TGAGGAAGGCAAATGAGGGAGAAGAGTGTGTTTAAAGGAGAACGGTAGGAGGCTAGGAGCGGGTGGGGAGGCGATG
page-top