Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig2441
Contig Information
Length 1065 bp
Tissue Seed DPA5
Clones 10 Clones [Download: CSV  ,  FASTA ]
whok10c19    whok4d19    whok5d13    whok9m12    whok14n05    rwhok10c19    rwhok4d19    rwhok5d13    rwhok9m12    rwhok14n05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribosomal protein [Bromus inermis]
Score 1221
Evalue 4.17762e-132
Total Hit Count 435
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig2441
GGCGGCGGCGCGTAGAACAGGAGAAGGAGCAGGCGGCGGCGGTGCCCGAAGAGGAGAAGCACGGCGACCTAGCCCGAGCTCGCAACCATGGCTAGGGGTT
TGAAGAAGCATCTGAAGAGGCTCAATGCCCCGTCTCACTGGATGCTTGACAAGCTTGGTGGAGCTTTTGCCCCCAAGCCATCATCTGGTCCTCACAAGGC
CAGGGAGTGCCTGCCTCTGATCCTCATCCTGAGGAACAGACTGAAATATGCTCTCACCTACCGTGAAGTGCAATCTATCCTTATGCAGCGTCATATCATG
GTTGATGGAAAGGTCCGCACTGACAAGACCTACCCTGCTGGGTTCATGGACATCATTTCCATTCCCAAGACTGGTGAGAACTACAGGCTTCTTTATGACA
CCAAGGGTCGCTTCCGCCTTCACTCTGTCAGGGATGAGGATGCTAAGTTCAAGCTCTGCAAGGTCAGGTCTGTCCAGTTCGGCCAGAAGGGCATCCCCTA
CCTGAACACCTATGATGGCCGCACCATCCGCTACCCAGACCCACTCATCAAGGCCAATGACACCATCAAGCTCGACCTGGAGACCAACAAGATTGTTGAC
TTCATCAAGTTTGACGTCGGCAATGTGGTCATGGTTACTGGTGGGCGCAACACTGGGCGTGTTGGTGTGATCAAGAACAGGGAGAAGCATAAGGGAACCT
TCGAGACCATCCACGTTGAGGATGCGCAGGGCCACCAGTTTGCCACCCGTCTGGGCAACGTGTTCACCATCGGCAAGGGCACCAAGCCGTGGGTGAGCCT
CCCCAAGGGCAAGGGTATCAAGCTCACCATCATTGAGGAGCAGAGGAAGCGGGATGCCGCTGCCCAGGCTGCTGCCAAGGCCTGATTCTGAGGCGTTGAG
TCGTTTTGCTATAGCCAGTTATCTTCAAGGATATAGACCTATGTTCCTGGAACCGTCGTTTTTAAGTTTTGCCTGATGTTTGTTGATTTGCGAACTCGTG
GTTGCTGCTAGATGTAATGTGGATGTTTACCTTATTAAGTGCTATTTCGAGACCTCATCTGGTAT
page-top