Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig2426
Contig Information
Length 1278 bp
Tissue Seed DPA5
Clones 9 Clones [Download: CSV  ,  FASTA ]
whok12e05    whok6k07    whok16k03    whok17l16    rwhok12e05    rwhok16k03    rwhok17l16    rwhok6k07    rwhok8h16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit cytosolic malate dehydrogenase [Triticum aestivum]
Score 1636
Evalue 4.10853e-180
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig2426
TTTTTTTTTTAATCAGGTGTCAAATTGTTTCACTCTTGCAGCAAATGTACTGTCCTGTAAATCATCAGGCAAAAGGGGAGCTACAAGCCTCATTCATACA
CACTTGGAAAACCAGCGAAAAGGAGCATGCATCGCGATGTGCGGCTGTTCTGGGTGGAGACGAGAGTTTCTAAAGAGCGGAAGGTTTCATTTATTCAAAA
CATCCAGAGGAGCAGCTGCCCTTCGAATGTGGATTTACGCCAGGCATGAGTAGGCCAACGCCTTCTCCTCTGACAGCTCCTGGGCGGTCGCATCCATCTT
CTTCCTCGAGAACTCATCGATCGGGAGCCCTTGAACAATTGTCCATTCACCACCACTGCACGTTACTGGGAAGGAGTAGATAAGACCAGCAGGCACACCG
TATGAACCATCAGAGTACACACCCATGGAAACAAATGTTCCCTCAGCGGTTCCCAGAACCCAGTCACGGATGTGATCACAAGCTGAGCTGGCAGCAGAGA
GAGCACTGGAGAGCTTCCTCGCTTTGATGATTGCAGCACCACGCTGCTGGACAGTGGCAATGAACTCCCCATTTAGCCATTCATCATCTTGAACAAGTTC
ACGAACAGGCTTCTCTCCACTGGGAGTCTTCACAGTGGCATGGTTAACATCAGGATACTGACTGGACGAGTGATTACCCCAGATAATAGCATTCTTAACG
TCAGAAACTTGGACACCAAGTCTCTCAGAAATCTGACCGAGTGCCCTGTTGTGGTCTAGGCGGGTCAAACAACTGATGTTCTTCTCAGGGATAGATGGAG
CAAACTCCTTCAGGATGAGAGCATTGGTGTTTGCTGGGTTGGCAACAACCAAAACCTTGCAATTGGGGGCTGCATGAGCTTCAAGAGCAGATGCTTGAGC
TTTGTAGATTGAAACATTTTTCGTCATAACATCCTTCCTTTCCATTCCTTCCTTCCTGGGGAATCCACCAACCATAACCGCAACATTCACACCAGTGCAA
GCCTCAACAACATCAGTTGTTGCAACAACTCCCTTGAGAAGTGGAAATGCGGCATCGATCAACTCCATCTTGACGCCTTTAAGAGCTTCAGCAGCAAATT
CAATATCCAGCATATGCAGAATAACAGGCTGGTCTGCACCAAGCATAACTCCCCTGGCAATCATGGGAACAAGAGCATATCCGATTTGTCCTGCGGCGCC
GGTGACGAGCACGCGCATCGGTTCCTTCGCCGCCATTGGAGCCGGGGGGTAGATTCTGGACAGCGGGGATAGGGAGAG
page-top