Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig2416
Contig Information
Length 584 bp
Tissue Seed DPA5
Clones 9 Clones [Download: CSV  ,  FASTA ]
whok2b07    whok5d21    whok5d22    whok13h22    rwhok2b07    rwhok3b07    rwhok5d21    rwhok5d22    rwhok13h22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribosomal protein P1 [Triticum aestivum]
Score 305
Evalue 2.15115e-26
Total Hit Count 343
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig2416
TTTTTTTTTTAGCAATGGCTTTTCAACCAAGCACCAAAACCATTTTCATTCTAAAAAGACCATCCCAAGGTGGTTTGCAGTACTCATTGCACAGATACTT
AGGTCTCAAACATATTAAATCCGCAAAATTCGACCTAAAAGCACATAAGATAAGTAATCCTTAGCATAAAAGATTCCACAGGAGAACTGGAATTGAACTG
CTTAGTCGAACAAGCTGAAGCCCATGTCATCATCGCTCTCTTCCTTAGCCTCCTCCTTTTTCTCTTCTTTCTTCTCTTCAGCGGCAGCAGCACCACCAGC
AGCCGGGGCAGCAGCAGCAGCAGCTGGAGCACCACCTCCACCAGATCCGACGGAAAGGATGAGGTCATCGACGCTCCTCTTCTCCAGGAGCTTGGCGAAG
AGCGCGGGCCAGTAGGCCTCAACCTTGATTCCGGCAGCCTTCACCACCGTCGCGATCTTCTCAGAAGTGATGGGGATCCCGTCATCGTGGAGGATGAGGG
CGGCAAGGGTGCAGGCGACCTCGCTGGAAGACATGGCGACGGATTCTCACCGGAGCAGATCTTGGGAGGCGATGGAAGTGGAGG
page-top