Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig2412
Contig Information
Length 893 bp
Tissue Seed DPA5
Clones 9 Clones [Download: CSV  ,  FASTA ]
whok4n22    whok5n22    whok13i23    whok13i24    whok13j11    rwhok17e17    rwhok4n22    rwhok13i23    rwhok13i24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit chloroplast oxygen-evolving enhancer protein 1 [Leymus chinensis]
Score 1194
Evalue 4.2428e-129
Total Hit Count 183
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig2412
TGGAGGTGAAGGGTACCGGCACCGCGAACCAGTGCCCGACCATCGACGGCGGCGTCGACTCCTTCCCCTTCAAGGCCGGCAAGTACGAGATGAAGAAGTT
CTGCCTGGAGCCCACCTCCTTCACCGTCAAGGCCGAGGGCATCCAGAAGAACGAGCCGCCGGCCTTCCAGAAGACCAAGCTCATGACCCGTCTCACCTAC
ACCCTTGACGAGATGGAAGGCCCGCTCGAGGTCGGCGCCGACGGCACCCTCAAGTTCGAGGAGAAGGACGGCATCGACTACGCGGCCGTCACCGTGCAGC
TCCCCGGAGGCGAGCGCGTGCCCTTCCTCTTCACCGTCAAGCAGCTCGTCGCCACCGGCAAGCCCGAGAGCTTCAGCGGGCCCTTCCTCGTGCCCAGCTA
CAGGGGTTCGTCTTTCCTCGACCCAAAGGGCCGTGGTGGCTCTACTGGCTACGACAACGCCGTGGCGCTACCCGCCGGAGGCAGAGGAGACGAGGAGGAG
TTGGCCAAGGAGAACGTGAAGAACGCGTCCTCCTCCACGGGCAACATCACGCTCAGCGTGACCAAGAGCAAGCCGGAGACCGGCGAGGTGATCGGCGTCT
TCGAGAGCGTGCAGCCGTCAGACACCGACCTCGGCGCCAAGGCGCCCAAGGATGTCAAGATCCAGGGTGTGTGGTACGCGCAGCTCGAGTCTAACTAGAG
CAGAGCAGAAGTGAAGATGCTCATCTTGTGTGCATGCGTACGTGGGTTGATCGTTGGAGAGGAAACAATCGAGGCAACAATGTGTGTTTGTGTGTGTATC
TAGTAATCTAAACCCAGGGTGTCGGTTTATATTTTAGCTTCTGTTATTGTTTCTTCCTCGCCAACTCATGATATTGACCCTCCAAAAAAAAAA
page-top