Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig2401
Contig Information
Length 1364 bp
Tissue Seed DPA5
Clones 8 Clones [Download: CSV  ,  FASTA ]
whok10c06    whok10h08    whok10h20    whok13e20    rwhok10c06    rwhok10h08    rwhok10h20    rwhok13e20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays]
Score 1415
Evalue 1.9072e-154
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig2401
TTTTTTTTTTACTCTAGTGAAATCAACAGAAACAAAGCGGACGATACACAAGTCGCCATATACAGTAACATGCAGTTCTAACCTCAGCCAGTCGGCCTGC
AGGCTAGCTACCACAGGTAGTAGATTCTTACACAACGAATAAAATGCCGATTCAAGTATGACTATATAAAACCAATGCCAAGGAATGTAAAGCATGATGA
CGTCCATGTCTCTTCATGGGGGCCAAGTGAAGTGATTTACAGGAACACGTCCTTCTCGAGCAGCTTGAGGACCTCGTCCTGGTTGTTCAGCTTGGCGACG
TCGATGGGCGTCTTCCCATCCATGTTTTGGAGAGTGACAGCAGCGCCGTGCTTCAACAGAAGATCCACACACTCTTTCCGGCCATAGCCAGCAGCGTAAT
GCAGTGGGGTGTTCTTGTTCTTATCCATGGCATCTACAGCAGCGCCCGCCTCAAGGAGGATTTCCGCACACTTGAACTCACCATATCCACATGCAAAGTG
CAAGGCCCTTCTTCCCTCAGAGTCTTCTTCATCCTTGTCTGCTCCACCATCTAGAGCCTTCTTCAGACCCTCACCGTCACCAACACTGGCAGTGTGGTGG
ACAATGGACTCGTCTTCATCTTCACCTTCTTCTTCAGTTTCTTCAGTACCAGAAGGTTCAGCAGTAGAGACAGTGCTAAATGGCATCGTAGTTCCCATTG
CCTGGCCAATCTTTTGAAGAGTTTCAGGGTCATTCCAGTACTTTATCATTGCAGCAGGACCACCATTCTCTAACTCATCAAGAATTGGCTTCAAGGCTGG
ATCGTCCTTAATCCGAGACATGCGCTCTTCAAGCTCCTCCTTATGTGATGGACTAGTCAAATTTTCCAGCATACTGGACATAGCAGGATCCTGCATAAGA
GCAGTCCCGAGGCGCTCTGCCATTGTCATAAACTGAGGGTTTTCCATGACCCTTTGCATTGTTTCCATGTATTGATGAGGATCCAATGGAGGCATGCCCT
GTTCTCCTGCAGTCTGAGCACCTTTCTGTAGCTGCTCAGCCATCTGATTGAATGCAGGGTCCCTTGCAATCTGATCCGCCATCTCCTTTATAGACGGATC
ATTGAGCAAACTTTGCATAGAAGAAAAATCGAAAGGACCCGACAAGCCTGCAGCAGCAGCTGGAGGAACCCCTTGACCTTCGTTGGATGATCCTTCTGTT
TTTTTACTTTTGCTCTCATCAGCGAACCCGGATGGGGGATCTCCACCCGACGCCATCCCGGTAGATACGAGGGGTAGGGGAAGAAGAATTCGTCCGAGGT
GGGCTGCTTGCGTCGGCCGGAGGCGGAGCTCGGCGGCGCGGTGGGGGAGGAGAGAGTGCTGCCA
page-top