Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig2394
Contig Information
Length 1159 bp
Tissue Seed DPA5
Clones 8 Clones [Download: CSV  ,  FASTA ]
whok10a14    whok12b14    whok4c09    whok9j09    rwhok10a14    rwhok12b14    rwhok4c09    rwhok9j09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os07g0435100 [Oryza sativa (japonica cultivar-group)] >gi|17297985|dbj|BAB78490.1| 26S proteasome regulatory particle non-ATPase subunit12 [Oryza sativa Japonica Group] >gi|34394724|dbj|BAC84087.1| 26S proteasome regulatory particle non-ATPase subunit12 [Oryza sativa Japonica Group] >gi|113611036|dbj|BAF21414.1| Os07g0435100 [Oryza sativa (japonica cultivar-group)] >gi|215692472|dbj|BAG87892.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215692486|dbj|BAG87906.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215715252|dbj|BAG95003.1| unnamed protein product [Oryza sativa Japonica Group]
Score 998
Evalue 4.52376e-120
Total Hit Count 196
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig2394
TAGCTCTTCCCCGCGGCGCCCGATCTCCGTACTTGGAGCCTTGGAGGAGACTCGAACCCTAATCCCCTCCCGCCTCGATCTCTCCCGCCGCCGCAGGAGA
GATCCCGCTCAGCCTCGGCTCCAATCCGCGACTCGACTCGACTCGAAGCTCCAGCTCCGCCGCCGCCCCCCGCCGCCGCCGATGGATCCGAAGCTGGTGG
AGGTGACGCAGCTGTTCGACCGCTTCAAGGCGGCCTTCAAGGCCAGCAATTTCGACGTCTGCTCGACCCTCCTCTCGCAGCTCAAGGTCCTCCTCACCAA
GTTCCCCCAGCCTACCCCCGCTGTTCCAGCAGACGCCCAACGCCGTGGAGGAGCTCAAGCTTGCGAGGGAAATTTATGAGCAGGCAGTTATTTTGAGTGT
GAAAATGGAAGACCAAGATGCATTTGAAAGGGACTTCTGCCAGCTCAAGCCGTATTACATGGACACATGTGGCATAATTCCTCCATCATCGGAGGAGTAC
CCAATCATGGGGGCTAACCTTCTGAGGCTGTTAGTCCAGAATAGAATTGCGGAGTTCCACACTGAGCTGGAGCTTCTTCCCGCCAAAGCGCTGGATAATG
CTTACATCAAGCACGGGGTTGAGCTCGAGCAGTCCTTTATGGAGGGCGCATACAACCGCGTGCTGAGCGCTCGACAAACCGCGCCGCATGAAACCTACAT
ATACTTCATGGACCTTCTCGTCAAAACGGTTAGAGACGAGATAGCTGGGTGCAGCGAGAAGGGATATGATTACCTGTCAATAAACGACGCGAAGCAGATG
TTTAAGTTCAGCTCCGACAAGGAACTGCAACAGTACATCGCAGAGGAACACCCCGAGTGGGATGTCAAGGATGGCCGGGTCTTGTTCCAGAAGGCGAAGG
AGTCCCAGCCCTGCAAGGAGATCCCGGCGGCGCCGGTCATCAACCAGACCCTTGGCTACGCGAGGGAATTGGAGAGGATTGTGTGATTTGTTTGCCTCTT
TTTTCTTCATCTTTGGACTGAGTTTCCCATGAAGAGGTGGATTATTGGATTGGATTGCCCTGTGACTCGGCTGTACTATTTTGTTAAATCGTTTGTTTCA
CCTACGGTTTCCAAAGCTACACAAGCTGTGAAATGTCGGCCTAAAATGGCACAAGAAAC
page-top