Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig2385
Contig Information
Length 814 bp
Tissue Seed DPA5
Clones 8 Clones [Download: CSV  ,  FASTA ]
whok10d11    whok13m23    whok13m24    whok16f01    rwhok10d11    rwhok16f01    rwhok13m23    rwhok13m24   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os08g0478200 [Oryza sativa (japonica cultivar-group)] >gi|32352148|dbj|BAC78567.1| hypothetical protein [Oryza sativa Japonica Group] >gi|42407865|dbj|BAD09007.1| putative mitochondrial F0 ATP synthase D chain [Oryza sativa Japonica Group] >gi|113624019|dbj|BAF23964.1| Os08g0478200 [Oryza sativa (japonica cultivar-group)] >gi|215695541|dbj|BAG90732.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218201320|gb|EEC83747.1| hypothetical protein OsI_29610 [Oryza sativa Indica Group]
Score 697
Evalue 1.52999e-71
Total Hit Count 94
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig2385
GTCACACAGCCCTAGCAAGTCTAGCAGATCCAGAGCCGAAGATGAGCGGGGTGAAGAAGGTGACGGACGTCGCGGCCAAGGCCGGGAAGGCGATCGATTG
GGACGGCCTGGCGAAGATGCTCGTCTCCGACGAGGCCCGAAAGGAGTTTGCCAACCTCCGCCGCACCTTCGAGGACGTCAACCACCAGCTCCAGACCAAG
TTCTCCCAGGAACCAAAGCCAATTGACTGGGAATACTACAAAAAAGGAATTGGATCGAAAGTTGTGGATATGTACAAGGAGGCTTATGATAGCATTGAGA
TCCCAAAGTATGTTGACACTGTCACTCCTGAGTATAAGCCAAAGTTTGATGCTCTGTTAATCGAAATGAAGGAAGCAGAGAAGACATCTCTGAAGGAATC
AGAGAGGATAGAGAAGGAGATTGCTGAATTGAAAGAGTTGAAGAAAAAGATCAGCACAATGACAGCAGACGAGTACTTTGCGAAGCACCCTGAACTCAAG
AAGAAGTTTGATGATGAGATCCGTAACGATTACTGGGGATACTAGATAACGGCGAAAGTCCAAGTTCTTTTACTAGAACATTCAATAATACTTCTTTGTC
CCTCTGGAATCTCATCATCCAAACTTGGGTGAATTCCATAACATGCGGACTGGGCTTGTTGAAATTCCGACATAACTCAGATCTTTGTGCTTTCTGTTGG
ACCTCATCATTTTATGGGTCGCCAGCTTATTTCATTGAAATTTTGTCTTGTGTTTAACTTTGCTCCTTTGTACAAGAGGATTTCTGCTATGGCTTGATTC
CAACAAAAAAAAAA
page-top