Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig2368
Contig Information
Length 1702 bp
Tissue Seed DPA5
Clones 8 Clones [Download: CSV  ,  FASTA ]
whok10f05    whok12f04    whok3i16    whok5o11    whok13d22    rwhok3i16    rwhok5o11    rwhok13d22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=UTP--glucose-1-phosphate uridylyltransferase; AltName: Full=UDP-glucose pyrophosphorylase; Short=UGPase; Short=UDPGP >gi|1212996|emb|CAA62689.1| UDP-glucose pyrophosphorylase [Hordeum vulgare subsp. vulgare]
Score 2151
Evalue 0
Total Hit Count 417
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig2368
CTCCTTCAGTCATCTGACATCTGCTCCCGTCCTCTCCTCTTCTCTTCCCCCCGAAGCAGCAGCGTCCCTCCTCTCCGCCCGGATCGCGATGGCCGCCGCC
GCCGTCGCCGCCGACTCCAAGATCGACAACCTCCGCGACGCCGTCGCCAAGCTCGGCGAGATCAGCGAGAACGAGAAGGCCGGGTTCATCAGCCTCGTCT
CGCGCTACCTCAGCGGCGAGGCGGAGCAGATCGAGTGGAGCAAGATCCAGACCCCCACCGATGAGGTGGTGGTGCCCTACGACACCCTCGCGCCCCCTCC
CGAAGATCTCGACGCCATGAAGGCCCTGCTCGACAAGCTCGTGGTGCTCAAGCTCAACGGAGGCCTCGGCACCACCATGGGCTGCACCGGCCCCAAGTCT
GTCATTGAAGTTCGCAATGGGTTTACATTTCTTGACCTTATTGTGATTCAGATTGAGTCCCTGAACAAGAAGTATGGATGCAGTGTTCCTTTGCTTCTAA
TGAACTCTTTCAACACTCATGATGACACACAGAAGATTGTTGAGAAGTACTCCAACTCCAACATTGAAATTCACACTTTCAACCAGAGCCAATACCCTCG
CATTGTTACTGAAGACTTCTTGCCACTTCCAAGCAAAGGGCAGACAGGGAAGGATGGCTGGTACCCCCCAGGCCACGGTGATGTGTTCCCCTCTTTGAAC
AACAGTGGAAAACTCGATACCTTGCTGTCACAGGGAAAGGAGTATGTCTTCGTGGCGAACTCAGACAACTTGGGTGCTATAGTTGACATCAAGATACTAA
ACCACCTGATCACTAACCAGAATGAGTACTGCATGGAAGTTACTCCAAAAACATTGGCTGATGTTAAAGGTGGTACCCTCATCTCATACGAAGGAAGAGT
CCAGCTCTTGGAGATTGCCCAAGTCCCTGATGAGCATGTGAATGAATTCAAGTCGATTGAGAAGTTCAAGATATTTAACACCAACAACCTGTGGGTGAAC
TTGAAGGCGATCAAGAGGCTTGTAGATGCTGAAGCACTTAAGATGGAAATCATTCCCAACCCTAAGGAAGTTGATGGCGTGAAAGTCCTGCAGCTAGAAA
CCGCAGCTGGAGCAGCGATCAGGTTCTTTGAGAAGGCAATCGGCATCAACGTTCCTCGCTCAAGGTTTCTGCCCGTGAAGGCTACATCTGATTTGTTGCT
TGTGCAGTCTGATCTCTATACCTTGGTCGATGGCTACGTCATCCGCAACCCAGCCAGAGTGAAGCCATCGAACCCTTCAATTGAGCTTGGTCCTGAGTTC
AAAAAGGTTGCCAACTTCCTTGCCCGTTTCAAGTCGATCCCCAGCATTGTTGAGCTCGACAGCTTGAAGGTCTCTGGCGATGTCTCGTTTGGCTCTGGAG
TCGTGCTCAAGGGCAACGTGACCATCGCAGCCAAGGCTGGAGTCAAGTTGGAGATCCCAGACGGAGCTGTGCTCGAGAACAAGGACATCAACGGCCCCGA
GGATCTTTGAGTGACGCCTGCTGCATCGCCAGTCGCGTTCCCAGAAACCTTCCTGTCCTCCTTCGCTGAGTTAACAGTCATGTAATTTTCGTGTGCATTC
TGCTGGGGTGTTGTCCTGGGATAGCCCCTTTACATAATAATTGTAATCCCCTCTGTGCTGTTCATCTACACTTGTTCTTCCTGGGCGTGCCAGGGACGTA
AA
page-top