Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig2361
Contig Information
Length 1414 bp
Tissue Seed DPA5
Clones 7 Clones [Download: CSV  ,  FASTA ]
whok11n03    whok12n16    whok14h11    rwhok10c02    rwhok11n03    rwhok12n16    rwhok14h11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit phosphoethanolamine methyltransferase [Triticum aestivum]
Score 2062
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig2361
GCACGTTACAAAGCGAGTCTCGCTCGTTCACAGTACAAGTTCAGGAATACAGCACGTACGTACACATTTATCTTATCTTACGGATCCTGGTGCCCAGCCA
GTGAATGCAGCCACTGCAACAAGCAAACAATCACACCCAACACCACACGGCCGCAGCACGGTGGAGCACCGATCCTCTTTATTTATTTCTTAACCGAAGC
CGCTCTGCTCCCGGATCATCGCGTCGCATGGCGTCGCTGCTCGGCGTCCAGATCACTTGGTCGCGATGAACAGCCCCCACTTCTGCTCGCCGGCGGAGCT
CCGCTTCAGCTTCGCGCTCCAGCCGTTGACGATGTCGTCGTAGTCCTCCTGGGTGAAGTCCGCCAGGAAGGCCTCCTTGTTCTTCTCGGTCTCGCCCAGC
TCCCTCTCCAGGACCCTCAGGAACTGGTCGGTGCGGTCTTCGGCGACGACATCGTGGAAACCGGCATCCTCAAGCATCTTTCCATAGGTCTTCACGTCAT
GGAGGTCATAGCCTCTCTGCTTGATGTATGCAGCAAATTCCTCTGACGGTGTCCCAGGGCTCCTGCAGTAGTCACTGATCAGCACTTTGCCCCCAGGCTT
GAGCCACTTGAAGAAGTTTCTGAACAGAGCAGGTTTGTCTTGAATGTGGAGGATGGTGTCACGGCTGTAGATCACATCAAACGTGTTCTCTGCGTATTCC
TTGGTGGTGCAGTCAGCAACCTCAAACTCAACCGAGCACGAGCGCCCGATGGCACGCTCGATCGCGAACGAAACCATGTTGATGGAAAGATCGATGCCGA
GGACATGGACATCATAGGTTTCAGCCATGTAGAAGTCACCTCCTCCGATGCCGCACCCAACATCGAGCACCTTCTGGCCAGCTTTCAGATCCAGCTTGTC
CACAAATTCTTTTGTGGTCTCGAATCCACCGGTGCTGACATAACCCTCCCCAAACACGCGCTCATAACGCAGGATTCCAGTGGATTTGTACTGCACATTG
TCCAGGAATCTCTGAAAGCCTTTGTCTTCTGTGCACTTGACCTTCTCCCATAGCCAACATATCTGGTTCTGGTTCTTCTTGCTTTTCACATAAGCTCCAA
TGCACTTGGAAGTTACCAGAGAAAGCTCAAAGGAATTCCCCTCTTGGTCATAGGAGTGGCATTCCTTAAACACCTTGGTGTAGAACCTCGGCTCCCGGTA
GTGCGTCGGGTTCACTTTCCTCTTGGAATCCCCAGACTGGTGGAAGCACGATTCCCTGATGAAAATATGCCCACCGGGCTTCAGCCACTTCACTATCCTG
CCAATCAGCTTCTCAACCTCCTCGTCGTTGAGGTACATGAGCAGCCAGTTGGAGAAGACGATGTCAATGGAGTTGTCCTCGATCTTGAGCTCCGGCGAGG
TGACGTCGGCGCAC
page-top