Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig2348
Contig Information
Length 660 bp
Tissue Seed DPA5
Clones 7 Clones [Download: CSV  ,  FASTA ]
whok10c04    whok5p17    whok14d07    rwhok10c04    rwhok11i17    rwhok5p17    rwhok14d07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays] >gi|195612550|gb|ACG28105.1| 60S ribosomal protein L33-B [Zea mays] >gi|195655257|gb|ACG47096.1| 60S ribosomal protein L33-B [Zea mays]
Score 542
Evalue 9.47896e-54
Total Hit Count 268
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig2348
TTTTTTTTTTAAAACCATCACTGAATCAGATTTGATAGCTAAAATTGCAAGGATAGAACGCAGAAAGTGGGCAAAAACAGCATCAGGTTCGAACTACATA
TAACATCATATAATGTGCGACCCACACATTCGAGATAACATGAAGACTACAGTTCTTCACAGTGAAACAGCAGTTCAACTTGCTATCCGGGCCTGAATCC
ATCTTACAAGACTCTGAAATGAAACCTAAGGGGCGAGCGAAATCCTCCACACTTCAAAGTAACCTTTTAGATGCTGCTCGGGTACATGAAGACCCTGACC
TTTTTCCCCATGGCCTCGGCGGGCAGGTTGGAGGTGAACTTGGCGCGGACGACGCCGGTGTTGCCGTGGGGGCGGGAGACCTTGCCCCAGATGCAGCGGT
AGTGGGTGCCGTTGCTCTTGGTCTTGGCCTTGTAGACGTAGGCCATCCTCTTGCCGCCGTACCAGGCCACGTCCTCCCTGGTGTTCACCCCCTCGATCTG
CACCAGTGACGCCGTCTCGTACTGGTTCGACTTGGACCGCTTGTATCCGAGGATGGTGCCGCGGACGTAGAGCCTCACGCGCTGGCCGGTGCGTCCCTTC
ACCATCTTGCTGTTGCGGCGGCGCCGGGGAGGGGAGCTGGGGGTTCGGGGTGAGCTGCGC
page-top