Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig2347
Contig Information
Length 691 bp
Tissue Seed DPA5
Clones 7 Clones [Download: CSV  ,  FASTA ]
whok10c07    whok9c07    whok9m22    whok9n09    rwhok9c07    rwhok9m22    rwhok9n09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_09485 [Oryza sativa Indica Group]
Score 654
Evalue 1.08608e-66
Total Hit Count 223
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig2347
CACCACCCCAACCCAACCCACCGGAGCAGACCAAGGCGGCGCCGCGGCGACCTCATCTCCGGCCAAGGGAAATGACTACCGTTCCGGGGTCTCTGGTGTG
GGAGCTGGTGAAGAAGAACAACTGCTTCTTGATCAAGCAGTTCGGCAACAGCAACGCCAAGGTGCAGTTCAGCAAGGAGCCCAACAACCTCTACAATGTC
CACTCCTACAAGTTCTCGGGCTTGGCGAACAGCAAGACCGTGGCGGTCCAGCCATCAGCAGGAGAGGACAAGGCTGTCATCCTTTCCACGACCAAGACCA
AGAAGCAGAACACCCCTGCCAAGCTCCAGCACAAGACTCTGATGCGCAAGGAGTTCCGCAAGATGGCCAAGTCTGTCAAGAACCAGGTCTGCGACAACTA
CTACAGGCCTGATCTGACCAAGCCGGCCCTTGCAAGGCTGAGCGCCGTGTACCGCAGCCTCCAGGTTTCAAAGTCTGGGATCAAGAAGAAGAACAGGCAG
CCAACTAAGCTGTAAAACTTGTTAAGCTCGCCTTTCAGCGCTCATGTTACCATGTCTGTTCCGACAGTTTTGAGTCATAAGTGAGACCCTTGGAGGAACC
ATGTTACAAACCCGCCCTAGTTTGTACCCTGACAGTGTTAGAAAATGGTTTGTGTCGATCTATAACTATTGTTTGATTCTCAAAAAAAAAA
page-top