Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig2319
Contig Information
Length 833 bp
Tissue Seed DPA5
Clones 7 Clones [Download: CSV  ,  FASTA ]
whok9f21    rwhok10a12    rwhok10f05    rwhok12f04    rwhok3j04    rwhok8l10    rwhok9f21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=UTP--glucose-1-phosphate uridylyltransferase; AltName: Full=UDP-glucose pyrophosphorylase; Short=UGPase; Short=UDPGP >gi|1212996|emb|CAA62689.1| UDP-glucose pyrophosphorylase [Hordeum vulgare subsp. vulgare]
Score 998
Evalue 2.01088e-106
Total Hit Count 288
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig2319
TTTTTTTTTTGAAGAACAAGTGTAGATGAACAGCACATAGGGGATTACAATTATTATGTAAAGGGGCTATCCCAGGACAACACCCCAGCAGAATGCACAC
GAAAATTACAGGACGGTTAACTCAGCGAAGGAGGACCGGAAGGTTTCTGGGAATGCGACTGGCGATGGCGGTGGGCGTCACTCAAAGATCCTCCGGGCCG
TTGATGTCCTTGTTCTCGAGCACAGCTCCGTCTGGGATCTCCAACTTGACTCCAGCCTTGGCTGCGATGGTCACGTTGCCCTTGAGCACGACTCCAGAGC
CAAACGAGACATCACCAGAGACCTTCAAGCTGTCGAGCTCAACGATGCTGGGGATCGACTTGAAACGGGCAAGGAAGTTGGCAACCTTTTTGAACTCAGG
ACCAAGCTCAATTGAAGGGTTTGATGGCTTCACTCTGGCTGGGTTGCGGATGACGTAGCCATCGACCAAGGTATAGAGATCAGACTGCACAAGCAACAAA
TCAGATGTAGCCTTCACGGGCAGAAACCTTGAGCGGGGAACGTTGATGCCGATTGCTTTCTCAAAGAACCTGATCGCTGCTCCAGCTGCGGTTTCTAGCT
GCAGGACTTTCACGCCATCAACTTCCTTAGGGTTGGGAATGATTTCCATCTTAAGTGCTTCAGCATCTACAAGCCTCTTGATCGCCTTCAAGTTCACCCA
CAGGTTGTTGGTGTTAAATATCTTGAACTTCTCAATCGACTTGAATTCATTCACATGCTCATCAGGGACTTGGGCAATCTCCAAGAGCTGGACCCTTCCT
TCGTATGAGATGAGGGTACCACCTTTAACATCA
page-top