Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig2301
Contig Information
Length 614 bp
Tissue Seed DPA5
Clones 6 Clones [Download: CSV  ,  FASTA ]
whok10a02    whok5b14    whok8h18    rwhok10a02    rwhok5b13    rwhok8h18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 5a2 protein [Zea mays]
Score 167
Evalue 2.4445e-10
Total Hit Count 69
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig2301
TTTTTTTTTTGGTCGTTCCGTTTATTCTTACTATTATTATTATTGGGATCTCACGGTAACATGCCATGGCAGATTACATTTTATGACGATGACCATAGCT
CACTAGCTCGGCATGCACGCACGCGCGGACTTTATTTATAGTTATTATTCTGCCATGAACCCTCCATCTCCTTCACCGGCCTTCCTCTCGCGCGATCCCC
ATGACCGAAACTCCTCACGCATGCGCGGATGGTGGTGGCACCCGCCCCCCGATGGTGTAAGTTCCGCATTTGCTCCCGACGGGGAGTTCGATGTGGCATT
CGTGGGCGAGGATGACGAGCTTCACGGGGCTGACGGTACGCTCGTCGGAGGCGGTGAGGACCCGGCAGATGCAGGGCACGTCAACCTTCTTCACCTCGCG
GCGGCAGTCCGGGGTCGGGGGCGTGTAGAAGCCCTGCTTCTTGATGCTCTCGATGCAGATGCTCATGATCATGTCCCTCTCGTCGTAGCAGTCCTTCTCC
CCCGCGGCGAGATGCGCCGCGAACCCGGCGACGATCGAGGCCAACAGCAGGAAGCGGACGAGGGTGGCTCTGGCGCTTCCCATCTTCGTGTGCTGCTGCT
GAGCTGCTGGCTAG
page-top