Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig2264
Contig Information
Length 775 bp
Tissue Seed DPA5
Clones 6 Clones [Download: CSV  ,  FASTA ]
whok19e19    whok10e23    whok11n08    rwhok10e23    rwhok11n08    rwhok19e19   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Histone H2B.3 >gi|125524425|gb|EAY72539.1| hypothetical protein OsI_00404 [Oryza sativa Indica Group]
Score 477
Evalue 4.57982e-46
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig2264
CCACCTTCAAGCTCATCCACACAAGCACCTCTCGGCTCTCCCGGTCGAAGCATCCGCATCCTCATCCATGGCCCCCAAGGCAGCCGAGAAGAAGCCGGTG
GAGAAGACCCCGGCGGGGAAGAAGCCCAAGGCGGAGAAGAAGGTGCCGGCGTCCAAGGAGGGCGGCGGCGACAAGAAGGGCAAGAAGAAGGCCAAGAAGA
GCGTGGAGACGTACAAGATCTACATCTTCAAGGTGCTGAAGCAGGTGCACCCGGACATCGGCATCTCCTCCAAGGCCATGTCCATCATGAACTCCTTCAT
CAACGACATCTTCGAGAAGCTGGCCGGCGAGTCCGCCAAGCTGGCGCGCTACAACAAGAAGCCCACCATCACGTCCCGCGAGATCCAGACCTCCGTCCGC
CTCGTCCTCCCCGGCGAGCTCGCCAAGCACGCCGTCTCTGAGGGCACCAAGGCCGTCACCAAGTTCACCTCCGCCTGATCTGGCCGTCTCCGTTTGTCTT
CTTTGATGGATGTATCGGTGTTGCTCTGTAGTAGTTAGCTGTTCGTGCTCTGTCGTGTTGTAGCTTGTGCTGGTTGTTTTGGATCACATTTCATGATCCG
GAGAAATAGTAATTTCAGTTCTTGATATGATCCGCTACTTTGTCTTGGTTCGATCTGTGGTGCGAGCTCGCCTTTTCTATGTAAATCTCTGCGGCAACGA
ATCTGAAACTTGCAGATATGTTCCTCTGTTTCAATTCTTAATTTCAGTTTCAGCTAACTGTTTAGAAAAAAAAAA
page-top