Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig2225
Contig Information
Length 1156 bp
Tissue Seed DPA5
Clones 6 Clones [Download: CSV  ,  FASTA ]
whok10f20    whok11e07    whok2h19    rwhok10f20    rwhok2h19    rwhok2h20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit triosephosphat-isomerase [Triticum aestivum]
Score 1241
Evalue 2.25795e-134
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig2225
GAGCAGTTGCATGCGGCCCCTACGGGACATGCGGCACACAACGGAGTGACCGGCGAAAGACACAACCGATCAGCCGATACACATTATTATCATTAATAGG
AGCTAAAGATTATTGCTGATATATGTTCAGTAGCAAACATTATCATTATTGGCTTGCAAGCTCAAGTCAGGGGGGGAGGAAAACAGTAGCAGCTGCTCCA
CCACAAAATTACTAGCATAGTACACACATAATAAACACAGGAGAAAAAAGGAGTCTCTTCATCTTCGCTGTCTTCCTCCGCACCGAGAGGAGCCACATCA
AGATTTTTCTTAGGCGGACTTCACGGTGGCGGCGTTGATGATGTCAATGAACTCAGGCTTCAAAGAAGCTCCACCAACGAGGAAACCATCAACGTCGGGC
TGCCCTGCCAACTCCTTGCAGCTTGCGCCAGTTACAGATCCTCCATAGATGATCCTCGTGGATTCAGCAACCTCGGGGCTCACATTGGTCTTGAGCCAGT
CCCTCAGATTGGCATGGACTTCCTGCGCCTGAGCCGGTGTCGCAACTTTACCGGTGCCAATGGCCCACACTGGTTCGTAAGCGACAACCACATTGGTCCA
GTCCTTGATCTTGCCAGCAATTGCTTTTGTCTGTTCAGCGACAACTGCCATGGTTGATCCAGCTTCTCGCTGCTCGAGAGTCTCACCAACACATGCAATG
ACCTTCAAGCCCTGAGCAAGTGCATATGCAACCTTCTCTCCAACAAACTCGCTTGATTCTCCCATCAAGCTCCTCCTTTCAGAGTGTCCAAGGATGACCC
AGGGAACGCCGAGGTTGACAAGCATCTCAGCACTGACTTCACCGGTGAAAGCACCGCCCTTCTTCACCCAGCAGTTCTGAGCAGCGACTTGGATCTCTGG
GCGCAGCTTACCCTTGACGGTGGGAAGGAAGACATAGGGCGGGCTGACGACAACCTCGACAACATCCGTAGAGGCGATCTGTCCAGCGTTCAGAGTGTTG
ACGATACTCTCTACCTGTTCCACAGTTCCATTGCATTTCCAGTTGCCGCCGACGAAGAACTTGCGGCCCATGGCGACGGAGGAGGGGGGAGATCGGATCG
GGTTGGGAACGACGGGCGGACGGGAGAGGGGGAGGTCGAGATTGGATTTGGTGGCG
page-top