Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig2219
Contig Information
Length 1880 bp
Tissue Seed DPA5
Clones 6 Clones [Download: CSV  ,  FASTA ]
whok12g10    whok13m04    whok17n08    rwhok12g10    rwhok17n08    rwhok13m04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit calnexin precursor [Zea mays]
Score 1966
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig2219
TTTTTTTTTTAAATGAACAGCATCTAAATATCAAAATATCCTTTCAGGTTTCGTTTGATACAAAAGGAAAAGAAGATCACTTCTAGCTGATTCCGGACAG
CACACAAACAACACAAGGCTTCACCGGCTCGTAGGTTCTAGCGCCTTAAAACTAGGGGTAGCAGCAGAGGGCAGCAAGACTGTTCGATTATACACTCGAG
GAGTTCACAAAAAGGCCAGGACCGAGACGTCCGAAATGTGAAGGTCCTAAGACCTAGCCTATGTCTCCCTTCGCGACCTTCTGCGTGGCACCGTCGTGTC
ATCCTCTTTCTCCTCCTTGTCGCCGCTGCTTCCAGCGGCATCGGCTTCCGTGGCACTGGGCTTCTTGACCTCGGCAACGGGCTTCACAGGTGCCACTGGC
TTCTTGCCACCGAAAATGGTTCTGAAGAGTACAGTCACAAGGATGACAGCGACTGAGGCCAAGATCGAAATTGTAATGTTGGGCTGCTTCTCTCCCTTCT
CAATAATATCAATGATCTTTATCTTGTAAGGTTCCAAGAATGGAATGTCGGCGATTTTGTACAAAACACTGAAGATCTTCTTCTGGAACTCAGAAAGGTC
CTCTGAATCGGCTGCTGCAGCCTCCTCAGCCTTCTGCTTTTCCTTCTCAACATCAAACTTGGGCTTCCATGTCTTCTCCAAGATGGCGGTGGCTACCTTC
TCATCATCGGCGATAAGAATGTTGTCAAAAAGGATGCCATCCTGCATTGTCCAGATCTCAATTCCAATAGCGGCAATCGGATCAAAGTCAGGCTTGTCAA
GCTCAAAGTATTCAGGGTTGGGGATTTCTTGGGGCTTCCAGATTCCCTTGTAGGCAGGGTTGTCAATCATGGGTGCATGCCACTTGCCCTTGTACGCAGG
GTTCTGCTTCATTGGCCTCTTCCATTCACCACATCCAGGTGCCTCTTCACACTTGGGGTTGTCAATCTTCGGTGCCTCCCATTCACCATCCTCCTCATCA
TCCCAGTCTTCGGGCTTAGCAGCCTCTGGGTCATCAACTTCCTCAGGCTCATCATCCAACCATCCTTCTGGCTTGGTGGCCTCCTCATCCAGAATTTCTG
TTGGGGCATCCTCATCCCAGTCATCGGGCTTCACTGCAGCTGGGTCAGGGATTTTAGCTCTCTCGTCCCAGTCCTCTGGCTTCTTGTCGTCAGGGTCAGG
AATAGTCTTTGATGGAATAAGTGCTGGCTCAAAATCATCAGCGGACAGGAAGTTTGCTTTGCTCTTCTCCTCCCCGTCAACCAAAATTCTGACCTCGTTA
TCCGGCTTCAAGATAGCCGTATAGACATGAGAGAGCTTGTCATATGGGACAGAGGGTGGGGACTTAAGGTGATGTTCAACATATTTGCCAGTCTTGGGGT
TCTTGTGCTTCAGGATGAAGTGAACCTTGTTCGTTGAACCACACTTGTCAGGACCAAACATAATTGTGTAAGGAGTGTCATTGTCAAATTCCTTGGCATC
CCATCCAGCCTCCTGAGGGCGAATGTACTTAAGATAAGCACCTCCACACTCGAGGCCATTCTGAAGCCTCACTTCGAACTGCAGGACAACTGTCCCATCC
TTCAAAGTAACAGGGCTATCAAGCTCTTTGACTATGGCATATTTCCTGGCTGGCTCACTGACAAGGAGACCATAGTCTTCATGGCCATCACTCTTCTCGT
GCTTCCATACACCTGAGTACTCTTCCTTGCCGGAGACGACCCAGCTCCCCTCGAAGCCCTCGTCGAAGGACTCGTGGAACAGCGGATCCGACGCGCGGAT
CTGCGCGAACAGCGCCGAGGCCACCAGAAGCGGCAGTAGGAGCACCGCGCGCCCTCCCGTCGTCATCCTCCCAGACCCGA
page-top