Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig2218
Contig Information
Length 853 bp
Tissue Seed DPA5
Clones 6 Clones [Download: CSV  ,  FASTA ]
whok10c16    whok10c18    whok14j23    rwhok10c16    rwhok10c18    rwhok14j23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative glycine-rich RNA-binding protein 2 [Bambusa oldhamii]
Score 346
Evalue 8.46685e-31
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig2218
ATTCCCCCCTTCCCACGCCGTCTCGTCCCAGCTCGCCCTCCAGAGGTTTTAGTCTTCCTCCATGGCGGCCCTCATCAAGCTCGGAAGCCTTCTTAGGCAG
AGTGCTTTGGCGAGCAGTGCCTCGACCGGCTCGGCTCCTGCCCTGTTCAACGCTGCCCGCTTCATGTGCGCCGGCCAGCCCGCTGGTGGCAATAAGCTTT
TCGTCGGCGGCCTGGCCTGGGCTACTGACGATCATTCGCTGAAGGAGGCGTTCCAAAGCTTTGGAGAGGTCGTTGAGGCACGTGTCATCACTGATCGAGA
GACTGGAAGGTCTAGAGGGTTTGGTTTTGTGAGCTTTGCGAATGAAGCTGATGCAGATAGCGCTGCAAAAGGCATGGACGGTCAGGAGCTTGCAGGGAGG
AACGTCCGTGTGAACTTCGCCAATGAGAGGCCTTCGGGTGGTGGCGGCTTCTCACGCGGCGGCGGTGGCTATGGAGGAGGTGGTGGCTTTGGCGGCGGCG
GCGGCTATGGTGGTGGCGGCGGCGGCTATGGCGGTGGTGGCCGAGGTGGCGGTGGCTATGGTGGTGACCGTGAAGCTTTCTAAGGAGAGCGCAGACTATC
AAATTTAAAATAATGCGCTTTTAGGACAGTGTCTTGATTATGTGGAACCTATGTCACGTCTGTCTGTTATCTGCGATAGTTGAACTCAATAGGAGCAGAG
ATGTGGTTCTAGTATTTTTGTTTTTGGTTCGTTTCTTGATGGTGCAAGAGTTTAAGTCATGCTGCTTCGAGGCTTGGATGAGTCTCAATGGAAGTTCATG
CATTTTGCCGTATATTGCACTGTGTACTTGTGGTGAGTCTCTGAGTTAAGTCG
page-top