Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig2193
Contig Information
Length 673 bp
Tissue Seed DPA5
Clones 6 Clones [Download: CSV  ,  FASTA ]
whok10b12    whok10d12    whok12f14    rwhok10b12    rwhok10d12    rwhok12f14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit non-specific lipid transfer protein 1 precursor [Triticum aestivum] >gi|94315723|gb|ABF14724.1| non-specific lipid transfer protein 1 precursor [Triticum aestivum]
Score 381
Evalue 4.67213e-35
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig2193
CAAATCTAGCTATTTCATCATCTCTGCCTGAGCTCACCACCACTACTAGTGCTAGCTAGCTTGATCGTGATGGCCCATTCTGCTGTTGCTCAGGTCGTGC
TCGTCGCCGTGGTGGCCGCTATGCTCCTCGCAGCCACGGAGGCGGCCGTATCGTGCGGTCAGGTGAGCTCTGCCTTGAGCCCCTGCATCTCCTATGCACG
CGGCAACGGCGCCAACCCGTCTGCGGCCTGCTGCAGCGGCGTTAGGAGTCTAGCCAGCTCAGCCCGGAGCACCGCTGACAAGCAAGCGGCGTGCAAGTGT
ATCAAGAGCGCTGCTGCTGGGCTCAACGCTGGCAAGGCCGCGGGCATCCCCACAAAGTGCGGCGTTAGCGTCCCCTACGCCATCAGCTCTTCGGTCGACT
GCTCTAAGATTCGCTGATCGAGCACTTGCTGCCATCGCTGTTGCTGGATCTACGCTTAGTATGTTGAGGTCACACACACGCACACACACATATATATATG
AATAAATGCTCTCATATTATCTCACTGCGTGAGAGAGAGAGGAGTACGTACGTCAAGCAGCTGTGCATGGCCGGCCCGAGTTTGGTTGTTCCTCCACTCC
CCGAGTATGCTGTACTTTGTACCATGTGTAATTTTGATATATGGATTGTATACTCAGCTGATCAAAAAAAAAA
page-top