Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

whfl_all.Contig3
Contig Information
Length 477 bp
Tissue Spikelet (at early flowering) full length cDNA
Clones 1 Clones [Download: CSV  ,  FASTA ]
whfl48l05   
Homology (BLAST) Top Hit hypothetical protein OsI_14101 [Oryza sativa Indica Group]
Score 574
Evalue 8.24811e-58
Total Hit Count 500
Registered year
Contig Sequence     [ Download ]
>whfl_all.Contig3
ctctcccgagtccgcagcagccgccgccagcagctgcgcaaaggctcctcaaaccctaaccctagtcctagcttagcttccttcttctcgatctagctag
agccatggcgccgaccaagggcgaggggccggccatcggcatcgacctcggcaccacctactcgtgcgtcggcgtgtggcagcacgaccgcgtcgagatc
atcgccaacgaccagggcaaccgcaccacgccctcgtacgtcgccttcaccgtcttcgatgcgaagcgtcttatcggcagaaggtttgctgatgcccctg
tccagagtgacattaagatgtggccgtacaaggttattcctggccctgcagacaagcctatgattgtagtgcagtacaagggtgaggacaagtagttttc
agctgaagaaatttcttccatggtcctcatcaagatgcgtgagatcgctgaggcttacctaggagtaactattaaga
page-top