Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig2160
Contig Information
Length 1025 bp
Tissue Seed DPA5
Clones 5 Clones [Download: CSV  ,  FASTA ]
whok10e10    whok17l11    rwhok10e10    rwhok15e21    rwhok17l11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit signal recognition particle 9 kDa protein [Zea mays] >gi|195653245|gb|ACG46090.1| signal recognition particle 9 kDa protein [Zea mays]
Score 438
Evalue 2.45737e-41
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig2160
CATCATGCATGGTTGTAGTACAAACGAAACCCAGCTGCATGCACGCATGCATGCGCACACTTGATCGCGTACGTACGTACGTGCACGGTCGGTTTCCAGA
CATAACACAACACCTAGCAGCTTACTTGCCGGGCACGAAGTTGGTGGCAAAGGCCCAGGCGTTGTTGTTGACGGGGTCGGCAAGGTGGTCGGCGAGGTTC
TCGAGAGGGCCCTTGCCGGTGACGATGGCCTGCACGAAGAAGCCGAACATGGAGAACATGGCGAGGCGGCCGTTCTCCTCGTGCCGAATTCGGCACGAGG
CGAGACCACGCCACAGCGCGGCGAAGCCCTAGCCTCCGGCCAGCGCCGCCGCCGCAGCGATGGTGTACTTCGACTCATGGGACGAGTTCGTCGACCGGTC
CGTGCAGCTCTTCCGCGCCGACCCCATCACCACTCGCTATTGTATGAAGTACCGGCACTGCGACGGGAAGCTCGTGCTCAAGGTCACCGACGACCGCGAG
TGCTTGAAGTTCAAGACGGATCAAGCTCAGGACGCAAAGAAGATGGAGAAGCTCAACAACATCTTTTTCGCTCTCATGACTCGTGGACCTGATGCTGACA
TAAGCGAGGTTTCAGGGAAGGAACAAGCGGAGCAGCAGCAATCAAAGAAGGGACGGGGCAGGAGGCAGTAGTATCATGCTCTGGATTTCTTTCAGAAAGA
TCACAACTGGGAGTGGTGGGTGGATATTTTGATCGACTCCTGTTAAGCCATGTTACAACTGTGAGTGGTGGGTGGTCTAAGAGTGGCGAGTAGTTTTCAA
GACAATGTGCGAGCCATCGTTGGATCCTTTTCCTGGCACAGAACCGCGAATTACACTTACCCACACAATCATGGTTGATGAGACAAATCAAATCTTTGAC
CGTCTGCGTGTTTTGTTGATGAATCATGGTTGACAAGACAATCAAATCATTCCCCGCCTGCGTGCTTTGGTGATGATTTTTCGTTCAGGAATATGGCAAA
ATGTTTTCTTGAATCAAAAAAAAAA
page-top