Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig2147
Contig Information
Length 832 bp
Tissue Seed DPA5
Clones 5 Clones [Download: CSV  ,  FASTA ]
whok2d22    whok9n11    whok9n20    whok16e22    whok18a06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Eukaryotic initiation factor 4A; Short=eIF-4A; AltName: Full=ATP-dependent RNA helicase eIF4A
Score 1186
Evalue 3.16603e-128
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig2147
CATCCCCTCATCGCCTCCGCTCCCACGCCGCCGAATCCGAGACCTGATCTCGGATTCACCGCAGCGACGCGACCAAACCCTCAGGCGATCCCCGGCACCT
CCTCCCCGACGCTTCAGCCATGGCAGGAATGGCACCGGAAGGTTCCCAGTTTGACGCTAAGAACTATGATTCTAAGATGCAGGAGCTGCTGAGCCAAGGT
GAGACTGAGGAGTTCTTCACCTCCTATGATGAAGTTCATGAGAGCTTTGATGACATGGGTCTCCAAGAGAACCTCCTCAGAGGAATTTATGCTTATGGTT
TTGAGAAGCCTTCTGCCATCCAGCAAAGGGGAATCGTTCCTTTCTGCAAGGGGCTTGATGTTATCCAGCAAGCACAATCTGGAACAGGAAAGACTGCTAC
TTTCTGTTCTGGAATCCTTCAACAGCTTGACTATGGTTTGGTTGAGTGCCAGGCCTTGGTCCTTGCTCCCACACGTGAGCTTGCACAGCAAATTGAGAAG
GTCATGCGTGCACTTGGTGACTACTTGGGTGTGAAGGTTCATGCATGTGTTGGAGGAACCTCAGTTCGTGAGGACCAAAGGATTCTTGCAAGTGGAGTGC
ATGTCGTTGTTGGTACTCCTGGTCGTGTGTTTGACATGCTCCGCAGGCAGTCTCTGCGCCCTGACAACATCAAGATGTTTGTCCTCGATGAAGCTGATGA
GATGCTTTCCCGTGGTTTCAAGGATCANATTTATGACATCTTCCAGCTTCTCCCAGGGAANATTCAAGTTGGTGTCTTCTCTGCCACCATGCCCCCTGAA
ACCCTTGANATTACCCGCAAGTTCATGAACAA
page-top