Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig2143
Contig Information
Length 1001 bp
Tissue Seed DPA5
Clones 5 Clones [Download: CSV  ,  FASTA ]
whok12d18    whok4a01    whok20k07    rwhok12d18    rwhok20k07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_38068 [Oryza sativa Indica Group]
Score 1094
Evalue 2.02173e-117
Total Hit Count 495
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig2143
CGACGCTCAGCCCCCAGACGCCGCAGCGCCGCCACTCCACCCGCAGCGGCAACCATGGCGGTCGGCAAGAACAAGCGCATCTCCAAGGGGAGGAAGGGTA
GCAAAAAGAAGGCCGTCGATCCGTTCACCAAGAAGCAGTGGTATGACATCAAGGCGCCGCTGCTGTTCACCAGCCGCAACGTCGGCAAGACCCTCGTGTC
CAGGACACAGGGTACCAAGATTGCCTCAGAGGGTCTGAAGCACAGGGTGTTCGAAGTATCTCTAGCTGATCTTCAGAACGATGAGGACCAGGCCTACAGG
AAGATCAGACTCCGTGCTGAGGATGTGCAAGGGATGAATGTCCTCACAAACTTCTGGGGCATGGACTTCACCACTGACAAGCTCAGGTCTCTTGTGAGGA
AGTGGCAGACACTCATTGAGGCTCATGTGGATGTGAAGACCACTGACAACTACATGCTCCGCATGTTCACCATTGGCTTCACGAAGAGACGCCCAAACCA
GGTGAAGCGCACTTGCTATGCCCAAGCAAGTCAGATCAGACAGATCCGCCGCAAGATGGTTGAGATCATGGTCAACCAAGCTGCAAGCTGTGACTTGAAG
GAGCTTGTGAACAAGTTCATCCCTGAGGTGATTGGAAAGGAGATTGAGAAGGCCACCTCAAGCATCTTCCCCCTCCAGAACGTGTACGTCCGCAAGGTGA
AGATCCTGAAGGCCCCCAAGTTTGACCTGGGGAAGCTCATGGAGGTGCACGGTGACTACAAGGAGGATGTTGGTGTGAAGCTTGACAGGCCTGCTGATGG
AGATGAGGTGATTCCTGGAGCGGAGGAGGTTGCTGCTGCTGAGTAGAAAATAGAAGTCGCTATTTTGCTGCTTCATATCTAGAAGATGATATATGTGCCA
CCTGGGTGTCGTGAACTTTGTAGTCAGTTTTGATGGCTGATTTCTTGAGTACTTCTGTCGACATTCCTAGCCAGCGTTCAGTTATCTTATTTTGTTCGTG
T
page-top