Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig2053
Contig Information
Length 983 bp
Tissue Seed DPA5
Clones 4 Clones [Download: CSV  ,  FASTA ]
whok10d07    whok7h03    rwhok10d07    rwhok7h03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ATP synthase delta chain [Zea mays] >gi|219887163|gb|ACL53956.1| unknown [Zea mays]
Score 732
Evalue 1.85634e-75
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig2053
CCCGACCCGATCTCCTCCTAGGTTTCGCTCTCCACCACCGCGGAACGAACCGGAAATGGCGGCGCGGCACCTCAGATCCGGCCTCCCGCTCCTCCAAGCT
CGCCTCGCGGCCAACGAATCCGCGGCCGTCGCTCAGGTATCGAGGGGGCTGGCAACGGAGGCGGATAAGCCTAAGGAGAACAAGATCAAGGTTCCAAAAG
CTCTGTATGGTGGCACCGGCAACTATGCTAGTGCGTTGTTCCTTGCAGCAGCCAACGCAAATTCGTTGGAAAAAGTTGAATCCGAGATTCTCGATGTTGT
AGGGGCATCCAAGAAGAGCCCTATGTTTTCTCAATTCATGAAGGACACATCAGTGCCTAAAGAAACCAGGGTGAAGGCTATAACTGAAATATTCTCTGAA
GCCGGGTTTACTGACATCACAAAGAAATTCTTGTCTGCACTGGCATCCAATGGAAGACTGAAATATGTTGAGCGCATTGCTGAGAGATTTGTTGATTTGA
CCATGGCACATAGGGGGGAGGTGAAAGTTGTTGTCAGGACTGTTGTTCCACTTCCTGATAAGGAGGAGAAAGAACTTAAGGAGACCTTGCGTGATATCCT
TGGGAAAGACAAAACCATCTTGGTTGAACAAAAGATTGACCAGAGTATCATGGGAGGACTGGTGATTGAATTTGGGCAGAAGGTGTTTGACATGTCGATC
AAGACTAGGGCGAAGCAAATGGAGGCATTCTTGAGACTACCCTTTGACATCTAACCGCCTTCGGATCTAAATCAACACCAGAGTGCAGTGGCTGAGCCGC
TGAAGGTTCCCTCATGTCTGCTTCTTCGATGTGGTCTTGAAATAAAAGCTTACCTTTACAAGAGAACGACACTCTGTTTTATTTTGTCTTGTGGGTTAGG
AAGAAGCCCGCTGAACAATCTTTAATTTCCTTTCTGCCAAAAAACATGGATAAAAACCATGAGGAGAGGTCCATGGAAAGTTT
page-top