Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_OKCS_all.Contig2050
Contig Information
Length 716 bp
Tissue Seed DPA5
Clones 4 Clones [Download: CSV  ,  FASTA ]
whok10d13    whok10d14    rwhok10d13    rwhok10d14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os06g0114700 [Oryza sativa (japonica cultivar-group)] >gi|7248408|dbj|BAA92731.1| unknown protein [Oryza sativa Japonica Group] >gi|55296186|dbj|BAD67904.1| unknown protein [Oryza sativa Japonica Group] >gi|113594646|dbj|BAF18520.1| Os06g0114700 [Oryza sativa (japonica cultivar-group)] >gi|215692581|dbj|BAG88001.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218197447|gb|EEC79874.1| hypothetical protein OsI_21376 [Oryza sativa Indica Group]
Score 624
Evalue 3.51786e-63
Total Hit Count 91
Registered year 2003
Contig Sequence     [ Download ]
>Wh_OKCS_all.Contig2050
GCTATTATCAATACAGTTGCTGGTTGCATCTGTTGTAAGAGGCATCCGGTTCCTTCAGACACTAACTGGAGTGTGGCTCTGATCTCATTCATCGTATCTT
GGGTCACTTTCATAATCGCGTTCCTTCTCCTGCTGACCGGAGCCGCGCTGAACGACCAAAGGGGCCAGGAGAACATGTACTTCGGCAGCTTCTGCTACGT
CGTCAAGCCGGGGGTCTTCTCCGGAGGGGCGGTGCTCTCCCTCGCGAGCGTGGCCCTGGCCATAGTCTACTACGTGGCCCTGACGTCGTCGAAAGGCCCG
CCGAGCTGGGGCCCGCAGCAGAACCAGGGCATCTCCATGGGCCAGCCCGTGATCCCGCAGCAGAGCAGCGAGCCGGTGTTCGTCCATGAGGACACCTACA
ACCGGCAACAGTTCCCATGAGTGATCACAGCCATATTCAAGCCAGCCATTTCGAGGGTCGCCCATGAGGACACTTGCAACCGGCAGCAGTTCCCGTGATC
GCAGTCGTAGTACCTAAGCCGTTTCGACGGCCCACATGAACGCTATGTTGGCGAGTTTGGTTTGTATAGCCCTGCAGGTTAGAACAATAGCAGCAGCTTG
GTTACCGTTATTATTAGCTAGGTTCATCAGTCTTCTCTTTTTCTTTGTTTGAGACTTGAGAAAGGCGGCGGCATGCCTGTTTCGTCGGTATGGATATTTG
AATTTTAAAAAAAAAA
page-top